c |
<flask.g of 'ckan.config.middleware.flask_app'> |
g |
<flask.g of 'ckan.config.middleware.flask_app'> |
h |
{'redirect_to': <function redirect_to at 0x7f0d1b98b1e0>, 'url': <function url at 0x7f0d1b98b2f0>, 'get_site_protocol_and_host': <function get_site_protocol_and_host at 0x7f0d1b98b268>, 'url_for': <function url_for at 0x7f0d1b98b488>, 'url_for_static': <function url_for_static at 0x7f0d1b98b620>, 'url_for_static_or_external': <function url_for_static_or_external at 0x7f0d1b98b6a8>, 'is_url': <function is_url at 0x7f0d1b98b730>, 'url_is_local': <function url_is_local at 0x7f0d1b98b840>, 'full_current_url': <function full_current_url at 0x7f0d1b98b8c8>, 'current_url': <function current_url at 0x7f0d1b98b950>, 'lang': <function lang at 0x7f0d1b98b9d8>, 'ckan_version': <function ckan_version at 0x7f0d1b98ba60>, 'lang_native_name': <function lang_native_name at 0x7f0d1b98bae8>, 'is_rtl_language': <function is_rtl_language at 0x7f0d1b98bb70>, 'get_rtl_theme': <function get_rtl_theme at 0x7f0d1b98bbf8>, 'get_rtl_css': <function get_rtl_css at 0x7f0d1b98bc80>, 'flash_notice': <function flash_notice at 0x7f0d1b98bd08>, 'flash_error': <function flash_error at 0x7f0d1b98d1e0>, 'flash_success': <function flash_success at 0x7f0d1b98d268>, 'are_there_flash_messages': <function are_there_flash_messages at 0x7f0d1b98d2f0>, 'link_to': <function link_to at 0x7f0d1b98d730>, 'file': <function file at 0x7f0d1b98d7b8>, 'submit': <function submit at 0x7f0d1b98d840>, 'nav_link': <function nav_link at 0x7f0d1b98d8c8>, 'wrapped': <function deprecated.<locals>.decorator.<locals>.wrapped at 0x7f0d1b98e7b8>, 'build_nav_main': <function build_nav_main at 0x7f0d1b98da60>, 'build_nav_icon': <function build_nav_icon at 0x7f0d1b98de18>, 'build_nav': <function build_nav at 0x7f0d1b98dea0>, 'build_extra_admin_nav': <function build_extra_admin_nav at 0x7f0d1b98e048>, 'default_group_type': <function default_group_type at 0x7f0d1b98e158>, 'get_facet_items_dict': <function get_facet_items_dict at 0x7f0d1b98e1e0>, 'has_more_facets': <function has_more_facets at 0x7f0d1b98e268>, 'unselected_facet_items': <function unselected_facet_items at 0x7f0d1b98e2f0>, 'get_param_int': <function get_param_int at 0x7f0d1b98e378>, 'sorted_extras': <function sorted_extras at 0x7f0d1b98e598>, 'check_access': <function check_access at 0x7f0d1b98e620>, 'linked_user': <function linked_user at 0x7f0d1b98e6a8>, 'group_name_to_title': <function group_name_to_title at 0x7f0d1b98e840>, 'truncate': <function truncate at 0x7f0d1b98e8c8>, 'markdown_extract': <function markdown_extract at 0x7f0d1b98e950>, 'icon_url': <function icon_url at 0x7f0d1b98e9d8>, 'icon_html': <function icon_html at 0x7f0d1b98ea60>, 'icon': <function icon at 0x7f0d1b98eae8>, 'resource_icon': <function resource_icon at 0x7f0d1b98eb70>, 'format_icon': <function format_icon at 0x7f0d1b98ebf8>, 'dict_list_reduce': <function dict_list_reduce at 0x7f0d1b98ec80>, 'gravatar': <function gravatar at 0x7f0d1b98ed08>, 'sanitize_url': <function sanitize_url at 0x7f0d1b98ed90>, 'user_image': <function user_image at 0x7f0d1b98ee18>, 'pager_url': <function pager_url at 0x7f0d1b98eea0>, 'get_page_number': <function get_page_number at 0x7f0d1b98ef28>, 'get_display_timezone': <function get_display_timezone at 0x7f0d1b98f048>, 'render_datetime': <function render_datetime at 0x7f0d1b98f0d0>, 'date_str_to_datetime': <function date_str_to_datetime at 0x7f0d1b98f158>, 'parse_rfc_2822_date': <function parse_rfc_2822_date at 0x7f0d1b98f1e0>, 'time_ago_from_timestamp': <function time_ago_from_timestamp at 0x7f0d1b98f268>, 'button_attr': <function button_attr at 0x7f0d1b98f510>, 'dataset_display_name': <function dataset_display_name at 0x7f0d1b98f598>, 'dataset_link': <function dataset_link at 0x7f0d1b98f620>, 'resource_display_name': <function resource_display_name at 0x7f0d1b98f6a8>, 'resource_link': <function resource_link at 0x7f0d1b98f730>, 'tag_link': <function tag_link at 0x7f0d1b98f7b8>, 'group_link': <function group_link at 0x7f0d1b98f840>, 'organization_link': <function organization_link at 0x7f0d1b98f8c8>, 'dump_json': <function dump_json at 0x7f0d1b98f950>, 'auto_log_message': <function auto_log_message at 0x7f0d1b98f9d8>, 'activity_div': <function activity_div at 0x7f0d1b98fa60>, 'snippet': <function snippet at 0x7f0d1b98fae8>, 'convert_to_dict': <function convert_to_dict at 0x7f0d1b98fb70>, 'follow_button': <function follow_button at 0x7f0d1b98fbf8>, 'follow_count': <function follow_count at 0x7f0d1b98fc80>, 'add_url_param': <function add_url_param at 0x7f0d1b98fd90>, 'remove_url_param': <function remove_url_param at 0x7f0d1b98fe18>, 'include_resource': <function include_resource at 0x7f0d1b98fea0>, 'urls_for_resource': <function urls_for_resource at 0x7f0d1b98ff28>, 'debug_inspect': <function debug_inspect at 0x7f0d1b990048>, 'popular': <function popular at 0x7f0d1b9900d0>, 'groups_available': <function groups_available at 0x7f0d1b990158>, 'organizations_available': <function organizations_available at 0x7f0d1b9901e0>, 'roles_translated': <function roles_translated at 0x7f0d1b990268>, 'user_in_org_or_group': <function user_in_org_or_group at 0x7f0d1b9902f0>, 'dashboard_activity_stream': <function dashboard_activity_stream at 0x7f0d1b990378>, 'recently_changed_packages_activity_stream': <function recently_changed_packages_activity_stream at 0x7f0d1b990400>, 'escape_js': <function escape_js at 0x7f0d1b990488>, 'get_pkg_dict_extra': <function get_pkg_dict_extra at 0x7f0d1b990510>, 'get_request_param': <function get_request_param at 0x7f0d1b990598>, 'html_auto_link': <function html_auto_link at 0x7f0d1b990620>, 'render_markdown': <function render_markdown at 0x7f0d1b9906a8>, 'format_resource_items': <function format_resource_items at 0x7f0d1b990730>, 'resource_preview': <function resource_preview at 0x7f0d1b9907b8>, 'get_allowed_view_types': <function get_allowed_view_types at 0x7f0d1b990840>, 'rendered_resource_view': <function rendered_resource_view at 0x7f0d1b9908c8>, 'view_resource_url': <bound method ResourceProxy.view_resource_url of <Plugin ResourceProxy 'resource_proxy'>>, 'resource_view_is_filterable': <function resource_view_is_filterable at 0x7f0d1b9909d8>, 'resource_view_get_fields': <function resource_view_get_fields at 0x7f0d1b990a60>, 'resource_view_is_iframed': <function resource_view_is_iframed at 0x7f0d1b990ae8>, 'resource_view_icon': <function resource_view_icon at 0x7f0d1b990b70>, 'resource_view_display_preview': <function resource_view_display_preview at 0x7f0d1b990bf8>, 'resource_view_full_page': <function resource_view_full_page at 0x7f0d1b990c80>, 'remove_linebreaks': <function remove_linebreaks at 0x7f0d1b990d08>, 'list_dict_filter': <function list_dict_filter at 0x7f0d1b990d90>, 'SI_number_span': <function SI_number_span at 0x7f0d1b990e18>, 'new_activities': <function new_activities at 0x7f0d1b990ea0>, 'uploads_enabled': <function uploads_enabled at 0x7f0d1b990f28>, 'get_featured_organizations': <function get_featured_organizations at 0x7f0d1b991048>, 'get_featured_groups': <function get_featured_groups at 0x7f0d1b9910d0>, 'featured_group_org': <function featured_group_org at 0x7f0d1b991158>, 'get_site_statistics': <function get_site_statistics at 0x7f0d1b9911e0>, 'resource_formats': <function resource_formats at 0x7f0d1b991268>, 'unified_resource_format': <function unified_resource_format at 0x7f0d1b9912f0>, 'check_config_permission': <function check_config_permission at 0x7f0d1b991378>, 'get_organization': <function get_organization at 0x7f0d1b991400>, 'license_options': <function license_options at 0x7f0d1b991488>, 'get_translated': <function get_translated at 0x7f0d1b991510>, 'facets': <function facets at 0x7f0d1b991598>, 'mail_to': <function mail_to at 0x7f0d1b991620>, 'radio': <function radio at 0x7f0d1b9916a8>, 'clean_html': <function clean_html at 0x7f0d1b991730>, 'flash': <ckan.lib.helpers._Flash object at 0x7f0d1c9ff828>, 'localised_number': <function localised_number at 0x7f0d1ca5b620>, 'localised_SI_number': <function localised_SI_number at 0x7f0d1ca5b730>, 'localised_nice_date': <function localised_nice_date at 0x7f0d1ca5b510>, 'localised_filesize': <function localised_filesize at 0x7f0d1ca5b6a8>, 'get_available_locales': <function get_available_locales at 0x7f0d1de36158>, 'get_locales_dict': <function get_locales_dict at 0x7f0d1de360d0>, 'literal': <class 'ckan.lib.helpers.literal'>, 'asbool': <function asbool at 0x7f0d1e2eb950>, 'urlencode': <function urlencode at 0x7f0d1f4acc80>, 'include_asset': <function include_asset at 0x7f0d1b986c80>, 'render_assets': <function render_assets at 0x7f0d1b986d90>, 'sanitize_id': <function sanitize_id at 0x7f0d1b991840>, 'compare_pkg_dicts': <function compare_pkg_dicts at 0x7f0d1b9918c8>, 'activity_list_select': <function activity_list_select at 0x7f0d1b991950>, 'get_collaborators': <function get_collaborators at 0x7f0d1b9919d8>, 'can_update_owner_org': <function can_update_owner_org at 0x7f0d1b991a60>, 'check_ckan_version': <function check_ckan_version at 0x7f0d1b991ae8>, 'csrf_input': <function csrf_input at 0x7f0d1b991b70>, 'related_resources': <function RelatedController.save_relationships at 0x7f0d18e189d8>, 'rdkit_visuals': <function RdkitVisualsController.display_image at 0x7f0d18e18488>, 'molecule_data': <function RdkitVisualsController.molecule_data at 0x7f0d18e18510>, 'alternate_names': <function RdkitVisualsController.alternames at 0x7f0d18e18598>, 'related_values': <function RdkitVisualsController.related_resources at 0x7f0d18e18620>, 'package_list_for_source': <function package_list_for_source at 0x7f0d08e1f7b8>, 'package_count_for_source': <function package_count_for_source at 0x7f0d08e1f598>, 'harvesters_info': <function harvesters_info at 0x7f0d08e1f620>, 'harvester_types': <function harvester_types at 0x7f0d08e1f510>, 'harvest_frequencies': <function harvest_frequencies at 0x7f0d08e1f400>, 'link_for_harvest_object': <function link_for_harvest_object at 0x7f0d08e1f488>, 'harvest_source_extra_fields': <function harvest_source_extra_fields at 0x7f0d08e1f2f0>, 'get_harvest_source': <function get_harvest_source at 0x7f0d08e1f378>, 'structured_data': <function structured_data at 0x7f0d192112f0>, 'relationship_get_entity_list': <function get_entity_list at 0x7f0d18ea20d0>, 'relationship_get_current_relations_list': <function get_current_relations_list at 0x7f0d18ea2400>, 'relationship_get_dataset_dict_from_dataset_id': <function get_dataset_dict_from_dataset_id at 0x7f0d18ea2378>, 'relationship_get_selected_json': <function get_selected_json at 0x7f0d18ea2950>, 'relationship_get_molecule_search_facets': <function get_molecule_search_facets at 0x7f0d18ea2ea0>, 'relationship_get_dataset_facets_for_molecule_search': <function get_dataset_facets_for_molecule_search at 0x7f0d18ea2f28>, 'scheming_language_text': <function scheming_language_text at 0x7f0d18f31d08>, 'scheming_field_choices': <function scheming_field_choices at 0x7f0d19014158>, 'scheming_choices_label': <function scheming_choices_label at 0x7f0d190141e0>, 'scheming_datastore_choices': <function scheming_datastore_choices at 0x7f0d19014268>, 'scheming_field_required': <function scheming_field_required at 0x7f0d190142f0>, 'scheming_dataset_schemas': <function scheming_dataset_schemas at 0x7f0d19014378>, 'scheming_get_presets': <function scheming_get_presets at 0x7f0d19014400>, 'scheming_get_preset': <function scheming_get_preset at 0x7f0d19014488>, 'scheming_get_dataset_schema': <function scheming_get_dataset_schema at 0x7f0d19014510>, 'scheming_get_dataset_form_pages': <function scheming_get_dataset_form_pages at 0x7f0d19014598>, 'scheming_group_schemas': <function scheming_group_schemas at 0x7f0d19014620>, 'scheming_get_group_schema': <function scheming_get_group_schema at 0x7f0d190146a8>, 'scheming_organization_schemas': <function scheming_organization_schemas at 0x7f0d19014730>, 'scheming_get_organization_schema': <function scheming_get_organization_schema at 0x7f0d190147b8>, 'scheming_get_schema': <function scheming_get_schema at 0x7f0d19014840>, 'scheming_field_by_name': <function scheming_field_by_name at 0x7f0d190148c8>, 'scheming_datetime_to_utc': <function scheming_datetime_to_utc at 0x7f0d190149d8>, 'scheming_datetime_to_tz': <function scheming_datetime_to_tz at 0x7f0d19014a60>, 'scheming_get_timezones': <function scheming_get_timezones at 0x7f0d19014ae8>, 'scheming_display_json_value': <function scheming_display_json_value at 0x7f0d19014b70>, 'scheming_render_from_string': <function scheming_render_from_string at 0x7f0d19014bf8>, 'scheming_flatten_subfield': <function scheming_flatten_subfield at 0x7f0d19014c80>, 'scheming_link_ts': <function scheming_link_ts at 0x7f0d19014d08>, 'scheming_get_source_unichem': <function scheming_get_source_unichem at 0x7f0d19014d90>, 'footer': <function FooterController.display_search_mol_image at 0x7f0d18e7b620>, 'searchbar': <function FooterController.searchbar at 0x7f0d18e7bea0>, 'mol_package_list': <function FooterController.mol_dataset_list at 0x7f0d18e7bf28>, 'package_list_for_every_inchi': <function FooterController.package_show_dict at 0x7f0d18e7c048>, 'get_molecule_data': <function FooterController.get_molecule_data at 0x7f0d18e7be18>, 'package_list': <function FooterPlugin.molecule_view_search at 0x7f0d18e7c8c8>, 'search_autocomplete_enable_default_implementation': <function enable_default_implementation at 0x7f0d18da0d90>, 'advanced_search_form_config': <function form_config at 0x7f0d18d986a8>, 'advanced_search_form_config_image': <function form_config_image at 0x7f0d18da0378>, 'spellcheck_did_you_mean': <function spellcheck_did_you_mean at 0x7f0d18d98ae8>, 'composite_search_get_prefix': <function get_prefix at 0x7f0d18ec5b70>, 'helper_available': <function helper_available at 0x7f0d19211268>, 'dcat_get_endpoint': <function get_endpoint at 0x7f0d19211ae8>, 'dcat_endpoints_enabled': <function endpoints_enabled at 0x7f0d19211a60>, 'repositories_dataset_present_count': <function repositories_dataset_present_count at 0x7f0d192a06a8>, 'get_measurement_count': <function get_measurement_count at 0x7f0d192a0730>} |
packages |
[{'author': 'Jeltsch, Albert, Bashtrykov, Pavel, Adam, Sabrina', 'author_email': None, 'creator_user_id': '1be646ae-ab26-47b8-8835-e4b27f11961e', 'id': 'doi-10-18419-darus-3334', 'isopen': False, 'language': 'English', 'license_id': '', 'license_title': '', 'maintainer': 'DaRUS', 'maintainer_email': None, 'metadata_created': '2023-05-08T19:14:12.861674', 'metadata_modified': '2023-05-08T19:14:12.861682', 'name': 'doi-10-18419-darus-3334', 'notes': '<b>Expression and purification of DNMT1 for biochemical work</b><br>\nFull length murine DNMT1 (UniProtKB <a href="https://www.uniprot.org/uniprot/P13864">P13864</a>) was overexpressed and purified as described (Adam, et al. 2020) using the Bac-to-Bac baculovirus expression system (Invitrogen). The expression construct of the DNMT1 with mutated CXXC domain was taken from Bashtrykov, et al. (2012).<br>\n\n<b>Synthesis long DNA substrate and methylation reactions with them</b><br>\nThe sequence of the 349 bp substrate with 44 CpG sites was taken from Adam et al. 2020. It was used in unmethylated and hemimethylated form. Generation of the substrates and the methylation reaction were conducted as described (Adam, et al. 2020). In brief, for the generation of hemimethylated substrates, the unmethylated DNA was methylated in vitro by M.SssI (purified as described in Adam, et al. 2020) to introduce methylation at all CpG sites, or by M.HhaI (NEB) together with M.MspI (NEB) to introduce methylation at GCGC and CCGG sites. For the synthesis of hemimethylated substrates, the upper strand of the methylated substrate was digested with lambda exonuclease, the ss-DNA purified and finally ds hemimethylated DNA was generated by by primer extension using Phusion® HF DNA Polymerase (Thermo). Methylation reaction were conducted using mixtures of UM, fully hemimethylated and patterned substrate (total DNA concentration 200 ng in 20 µL) in methylation buffer (100 mM HEPES, 1 mM EDTA, 0.5 mM DTT, 0.1 mg mL-1 BSA, pH 7.2 with KOH) containing 1 mM AdoMet. DNMT1 concentrations and incubation times are indicated in the text. Methylation was followed by bisulfite conversion using the EZ DNA Methylation-LightningTM Kit (ZYMO RESEARCH) followed by library generation and Illumina paired-end sequencing (Novogene).<br>\n\n<b>Flanking sequence preference analysis with randomized single-site substrates</b><br>\nMethylation reactions of the randomized substrate with DNMT1 were performed similarly as described (Adam, et al. 2020; Gao, et al. 2020). Briefly, single-stranded oligonucleotides containing a methylated, hydroxymethylated or unmethylated CpG site embedded in a 10 nucleotide random context were obtained from IDT and used for generation of 67 bps long double-stranded DNA substrates by primer extension. Pools of these randomized substrates were then mixed in different combination, methylated by DNMT1 in methylation buffer (100 mM HEPES, 1 mM EDTA, 0.5 mM DTT, 0.1 mg mL-1 BSA, pH 7.2 with KOH) containing 1 mM AdoMet. DNMT1 concentrations and incubation times are indicated in the text. Methylation was followed by bisulfite conversion using the EZ DNA Methylation-LightningTM Kit (ZYMO RESEARCH) followed by library generation and Illumina paired-end sequencing (Novogene).<br>\n\n<b>Bioinformatics analysis</b><br>\nNGS data sets were bioinformatically analyzed using a local instance of the Galaxy server as described (Adam, et al. 2020; Dukatz, et al. 2020; Dukatz, et al. 2022). In brief, for the long substrate, reads were trimmed, filtered by quality, mapped against the reference sequence and demultiplexed using substrate type and experiment specific barcodes. Afterwards, methylation information was assigned and retrieved by home-made skripts. For the randomized substrate, reads were trimmed and filtered according to the expected DNA size. The original DNA sequence was then reconstituted based on the bisulfite converted upper and lower strands to investigate the average methylation state of both CpG sites and the NNCGNN flanks using home-made skripts. Methylation rates of 256 NNCGNN sequence contexts in the competitive methylation experiments with the mixed single-site substrates were determined by fitting to monoexponential reaction progress curves with variable time points with MatLab skripts as described (Adam, et al. 2022). Pearson correlation factors were calculated with Excel using the correl function.<br>\n\n<b>Structure of the deposited data</b><br>\nMethylation data of long substrates are placed in the “long DNA substrates” folder. Methylation data of short single-site substrates with randomized flanks are placed in the “single sites substrates” folder. In both folder an explanatory pdf file gives further information. Subfolders are arranged by enzyme (CXXC mutant or DNMT1 WT). Then, for each enzyme, the different substrates or substrate mixtures are provided in separate subfolders.<br>\n\n<b>References</b><br>\n<li>Adam S, Bräcker J, Klingel V, Osteresch B, Radde NE, Brockmeyer J, Bashtrykov P, Jeltsch A. Flanking sequences influence the activity of TET1 and TET2 methylcytosine dioxygenases and affect genomic 5hmC patterns. Communications Biology 5, 92 (2022)\n<li>Adam S, Anteneh H, Hornisch M, Wagner V, Lu J, Radde NE, Bashtrykov P, Song J, Jeltsch A. DNA sequence-dependent activity and base flipping mechanisms of DNMT1 regulate genome-wide DNA methylation. Nature Commun 11, 3723 (2020)\n<li>Bashtrykov P, et al. Specificity of Dnmt1 for methylation of hemimethylated CpG sites resides in its catalytic domain. Chem Biol 19, 572-578 (2012)\n<li>Dukatz M, Dittrich M, Stahl E, Adam S, de Mendoza A, Bashtrykov P, Jeltsch A. DNA methyltransferase DNMT3A forms interaction networks with the CpG site and flanking sequence elements for efficient methylation. J. Biol. Chem. 298(10), 102462 (2022)\n<li>Dukatz M, Adam S, Biswal M, Song J, Bashtrykov P, Jeltsch A. Complex DNA sequence readout mechanisms of the DNMT3B DNA methyltransferase. Nucleic Acids Res 48, 11495-11509 (2020)\n<li>Gao L, Emperle M, Guo Y, Grimm SA, Ren W, Adam S, Uryu H, Zhang ZM, Chen D, Yin J, Dukatz M, Anteneh H, Jurkowska RZ, Lu J, Wang Y, Bashtrykov P, Wade PA, Wang GG, Jeltsch A, Song J. Comprehensive Structure-Function Characterization of DNMT3B and DNMT3A Reveals Distinctive De Novo DNA Methylation Mechanisms. Nature Commun 11, 3355 (2020)\n<br><br>\n<b>Data set 1</b> contains the combined methylation rates of all 256 NNCGNN sequences in HM, OH and UM context by DNMT1, as well as their corresponding standard error of the mean (SEM) values. For details how these numbers were determined refer to the description in the corresponding publication.', 'num_resources': 1, 'num_tags': 8, 'organization': {'id': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'name': 'darus', 'title': 'DaRUS', 'type': 'repository', 'description': 'Chemistry collection from DaRUS, the data repository of the University of Stuttgart.', 'image_url': 'logoDarusKreis.png', 'created': '2023-05-03T09:01:04.791551', 'is_organization': True, 'approval_status': 'approved', 'state': 'active'}, 'owner_org': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'private': False, 'related_molecule': [], 'state': 'active', 'title': 'NGS data related to Adam et al.: On the accuracy of the epigenetic copy machine - comprehensive specificity analysis of the DNMT1 DNA methyltransferase', 'type': 'dataset', 'extras': [{'key': 'contributor', 'value': 'Jeltsch, Albert'}, {'key': 'creator', 'value': 'Jeltsch, Albert'}, {'key': 'date', 'value': '2023-04-04T00:00:00'}, {'key': 'identifier', 'value': 'https://doi.org/10.18419/darus-3334'}, {'key': 'metadata_modified', 'value': '2023-04-28T00:00:05'}, {'key': 'set_spec', 'value': 'all'}, {'key': 'harvest_object_id', 'value': '1d155cce-62c5-4d8f-86d7-eb3768892c4d'}, {'key': 'harvest_source_id', 'value': '8ba5ef26-d024-46cd-8099-94f1e74e7a36'}, {'key': 'harvest_source_title', 'value': 'Darus Test Harvest'}], 'resources': [{'cache_last_updated': None, 'cache_url': None, 'created': '2023-05-08T19:14:12.863643', 'format': 'HTML', 'hash': '', 'id': '51461cc1-1b40-41bc-b7f9-7f0efe0f67c5', 'last_modified': None, 'metadata_modified': '2023-05-08T19:14:12.830220', 'mimetype': None, 'mimetype_inner': None, 'name': 'NGS data related to Adam et al.: On the accuracy of the epigenetic copy machine - comprehensive specificity analysis of the DNMT1 DNA methyltransferase', 'package_id': 'doi-10-18419-darus-3334', 'position': 0, 'resource_type': 'HTML', 'size': None, 'state': 'active', 'url': 'https://doi.org/10.18419/darus-3334', 'url_type': None}], 'tags': [{'display_name': 'chemistry', 'id': '20e4e978-2a22-4286-a18b-4ae22d1ffca1', 'name': 'chemistry', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dna-methylation', 'id': 'e7346e2a-6a27-4ef7-9a8a-67d86bc040c4', 'name': 'dna-methylation', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dna-methyltransferase', 'id': '535aedd5-dcf4-4470-90a5-ab689b1b456e', 'name': 'dna-methyltransferase', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dnmt1', 'id': 'c2bc85f9-cd83-41a3-bb3d-d00f697ff0ad', 'name': 'dnmt1', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'enzyme-assay', 'id': 'f4d04af7-98e2-455a-a8ec-5ae1aab87681', 'name': 'enzyme-assay', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'enzyme-specificity', 'id': 'a9460414-cc78-4daa-aa69-952291b72087', 'name': 'enzyme-specificity', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'medicine-health-and-life-sciences', 'id': 'fb4c5813-8e73-46a1-ba71-17094769b523', 'name': 'medicine-health-and-life-sciences', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'raw-dna-sequences-extracted-from-fastq-ngs-files-bisulfite-seq-of-5mc-analysis', 'id': '926440e2-39e5-4f03-9eb2-2cc6387f2f2c', 'name': 'raw-dna-sequences-extracted-from-fastq-ngs-files-bisulfite-seq-of-5mc-analysis', 'state': 'active', 'vocabulary_id': None}], 'groups': [], 'relationships_as_subject': [], 'relationships_as_object': []}, {'author': 'Jeltsch, Albert, Bashtrykov, Pavel, Dukatz, Michael, Adam, Sabrina', 'author_email': None, 'creator_user_id': '1be646ae-ab26-47b8-8835-e4b27f11961e', 'id': 'doi-10-18419-darus-2993', 'isopen': False, 'language': 'English', 'license_id': '', 'license_title': '', 'maintainer': 'DaRUS', 'maintainer_email': None, 'metadata_created': '2023-05-08T19:13:56.226018', 'metadata_modified': '2023-05-08T19:13:56.226023', 'name': 'doi-10-18419-darus-2993', 'notes': 'The naming of the files is described in the Supplemental Tables 1 of the accompanying manuscript.', 'num_resources': 1, 'num_tags': 9, 'organization': {'id': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'name': 'darus', 'title': 'DaRUS', 'type': 'repository', 'description': 'Chemistry collection from DaRUS, the data repository of the University of Stuttgart.', 'image_url': 'logoDarusKreis.png', 'created': '2023-05-03T09:01:04.791551', 'is_organization': True, 'approval_status': 'approved', 'state': 'active'}, 'owner_org': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'private': False, 'related_molecule': [], 'state': 'active', 'title': 'NGS data related to Dukatz et al.: DNA methyltransferase DNMT3A forms interaction networks with the CpG site and flanking sequence elements for efficient methylation', 'type': 'dataset', 'url': 'Bisulfite-seq DNA methylation analysis', 'extras': [{'key': 'contributor', 'value': 'Jeltsch, Albert'}, {'key': 'creator', 'value': 'Jeltsch, Albert'}, {'key': 'date', 'value': '2022-09-27T00:00:00'}, {'key': 'identifier', 'value': 'https://doi.org/10.18419/darus-2993'}, {'key': 'metadata_modified', 'value': '2022-11-29T01:00:05'}, {'key': 'set_spec', 'value': 'all'}, {'key': 'harvest_object_id', 'value': '058d1346-3f8c-4576-a756-218403628fd1'}, {'key': 'harvest_source_id', 'value': '8ba5ef26-d024-46cd-8099-94f1e74e7a36'}, {'key': 'harvest_source_title', 'value': 'Darus Test Harvest'}], 'resources': [{'cache_last_updated': None, 'cache_url': None, 'created': '2023-05-08T19:13:56.227703', 'format': 'HTML', 'hash': '', 'id': '7f8432f4-9256-4b79-b50f-5904435a0e7b', 'last_modified': None, 'metadata_modified': '2023-05-08T19:13:56.212450', 'mimetype': None, 'mimetype_inner': None, 'name': 'NGS data related to Dukatz et al.: DNA methyltransferase DNMT3A forms interaction networks with the CpG site and flanking sequence elements for efficient methylation', 'package_id': 'doi-10-18419-darus-2993', 'position': 0, 'resource_type': 'HTML', 'size': None, 'state': 'active', 'url': 'https://doi.org/10.18419/darus-2993', 'url_type': None}], 'tags': [{'display_name': 'bisulfite-sequencing', 'id': 'cc9cbc1b-80c9-46c0-bfa3-e6f82923eb72', 'name': 'bisulfite-sequencing', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'chemistry', 'id': '20e4e978-2a22-4286-a18b-4ae22d1ffca1', 'name': 'chemistry', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dna-methylation', 'id': 'e7346e2a-6a27-4ef7-9a8a-67d86bc040c4', 'name': 'dna-methylation', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dna-methyltransferase', 'id': '535aedd5-dcf4-4470-90a5-ab689b1b456e', 'name': 'dna-methyltransferase', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dnmt3a', 'id': '1ce1eeaf-6ac8-4fb0-9456-fbd33ca8c0a9', 'name': 'dnmt3a', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'enzyme-assay', 'id': 'f4d04af7-98e2-455a-a8ec-5ae1aab87681', 'name': 'enzyme-assay', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'medicine-health-and-life-sciences', 'id': 'fb4c5813-8e73-46a1-ba71-17094769b523', 'name': 'medicine-health-and-life-sciences', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'ngs-bisulfite-sequencing', 'id': '13051ab0-0f55-4da6-9725-55108bf87ee1', 'name': 'ngs-bisulfite-sequencing', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'raw-dna-sequences-in-fastqsanger-format', 'id': '690b0510-4dfe-487d-89b3-878664cbb4d8', 'name': 'raw-dna-sequences-in-fastqsanger-format', 'state': 'active', 'vocabulary_id': None}], 'groups': [], 'relationships_as_subject': [], 'relationships_as_object': []}, {'author': 'Jeltsch, Albert, Bashtrykov, Pavel, Adam, Sabrina, Mack, Alexandra, Emperle, Max', 'author_email': None, 'creator_user_id': '1be646ae-ab26-47b8-8835-e4b27f11961e', 'id': 'doi-10-18419-darus-2231', 'isopen': False, 'license_id': '', 'license_title': '', 'maintainer': 'DaRUS', 'maintainer_email': None, 'metadata_created': '2023-05-08T19:13:37.638623', 'metadata_modified': '2023-05-08T19:13:37.638628', 'name': 'doi-10-18419-darus-2231', 'notes': '<p>Methylation of substrate libraries<br>\nSingle-stranded DNA oligonucleotides used for generation of double stranded substrates with a distance of 12 base pairs between CpG sites were obtained from IDT. Second strand synthesis was conducted by a primer extension reaction using one universal primer. The obtained library of double-stranded DNA oligonucleotides was methylated by different purified heterotetramers containing DNMT3A catalytic domain and DNMT3A R882H catalytic domain subunit, boht either containing a His-tag or MBD-tag. For this it was incubated for 60 min at 37 °C in the presence of 0.8 mM S-adenosyl-L-methionine (Sigma) in reaction buffer (20 mM HEPES pH 7.5, 1 mM EDTA, 50 mM KCl, 0.05 mg/mL bovine serum albumin). DNA concentrations were 107 nM, DNMT3A concentrations were used between 0.05 and 0.1 µM. Reactions were stopped by shock freezing in liquid nitrogen, then treated with proteinase K for 2 hours at 42 °C. Afterwards DNA was digested with BsaI-HFv2 enzyme and a hairpin (pGAGAAGGGATGTGGATACACATCCCT) was ligated using T4 DNA ligase (NEB). DNA was bisulfite converted using EZ DNA Methylation-Lightning kit (ZYMO RESEARCH) according to the manufacturer protocol, purified and eluted with 10 µL ddH2O.</p>\n\n<p>NGS library generation<br>\nLibraries for Illumina Next Generation Sequencing (NGS) were produced with the two-step PCR approach. In the first PCR, 2 µL of bisulfite-converted DNA were amplified with the HotStartTaq DNA Polymerase (QIAGEN) and primers containing internal barcodes using following conditions: 15 min at 95 °C, 10 cycles of 30 sec at 94 °C, 30 sec at 50 °C, 1 min and 30 sec at 72 °C, and final 5 min at 72 °C; using a mixture containing 1x PCR Buffer, 1x Q-Solution, 0.2 mM dNTPs, 0.05 U/µL HotStartTaq DNA Polymerase, 0.4 µM forward and 0.4 µM reverse primers in a total volume of 20 µL. In the second PCR, 1 µL of obtained products were amplified by Phusion Polymerase (Thermo) with another set of primers to introduce adapters and indices needed for NGS (30 sec at 98 °C, 10 cycles - 10 sec at 98 °C, 40 sec at 72 °C, and 5 min at 72 °C). PCRII was carried out in 1x Phusion HF Buffer, 0.2 mM dNTPs, 0.02 U/µL Phusion HF DNA Polymerase, 0.4 µM forward and 0.4 µM reverse primers in a total volume of 20 µL. Obtained libraries were pooled in equimolar amounts, purified and sequenced in the Max Planck Genome Centre Cologne.</p>\n\n<p>Bioinformatic analysis<br>\nBioinformatic analysis of obtained NGS data was conducted with a local Galaxy server and with home written scripts. Briefly, fastq files were analyzed by FastQC, 3’ ends of the reads with a quality lower than 20 were trimmed and reads containing both full-length sense and antisense strands were selected. Next, the samples were split using the internal barcodes with respect to the different experimental conditions. Afterwards the insert DNA sequence was extracted and used for further downstream analysis. The uploaded text files contain the bisulfite converted sequences with pairs of CpG sites in 12 bp distance as described in the furhter documentation (info.pdf).</p>\n\nThe naming of the files is as follows:<br>\nName, Complex, Repeat, c(DNMT3AC) [µM]<br>\n1WW, His-WT/MBP-WT, R1, 0.1<br>\n2WW, His-WT/MBP-WT, R2, 0.05<br>\n1RR, His-R882H/MBP-R882H, R1, 0.1<br>\n2RR, His-R882H/MBP-R882H, R2, 0.07<br>\n1RW, His-R882H/MBP-WT, R1, 0.1<br>\n2RW, His-R882H/MBP-WT, R2, 0.1<br>\n1WR, His-WT/MBP-R882H, R1, 0.1<br>\n2WR, His-WT/MBP-R882H, R2, 0.1<br>', 'num_resources': 1, 'num_tags': 7, 'organization': {'id': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'name': 'darus', 'title': 'DaRUS', 'type': 'repository', 'description': 'Chemistry collection from DaRUS, the data repository of the University of Stuttgart.', 'image_url': 'logoDarusKreis.png', 'created': '2023-05-03T09:01:04.791551', 'is_organization': True, 'approval_status': 'approved', 'state': 'active'}, 'owner_org': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'private': False, 'related_molecule': [], 'state': 'active', 'title': 'Data related to "Preferential interaction of DNMT3A subunits containing the R882H cancer mutation leads to dominant changes of flanking sequence effects"', 'type': 'dataset', 'url': 'Bisulfite-seq DNA methylation analysis', 'extras': [{'key': 'contributor', 'value': 'Jeltsch, Albert'}, {'key': 'creator', 'value': 'Jeltsch, Albert'}, {'key': 'date', 'value': '2021-11-11T00:00:00'}, {'key': 'identifier', 'value': 'https://doi.org/10.18419/darus-2231'}, {'key': 'metadata_modified', 'value': '2022-11-29T01:00:04'}, {'key': 'relation', 'value': 'Jeltsch, Albert; Bashtrykov, Pavel; Adam, Sabrina; Kunert, Stefan: Data related to "Structural and biochemical insight into the mechanism of dual CpG site binding and methylation by DNMT3A. \nDOI: <a href="https://doi.org/10.18419/darus-1781">10.18419/darus-1781</a>'}, {'key': 'set_spec', 'value': 'all'}, {'key': 'harvest_object_id', 'value': '1b040aab-70bf-4f4e-890d-82448acb4453'}, {'key': 'harvest_source_id', 'value': '8ba5ef26-d024-46cd-8099-94f1e74e7a36'}, {'key': 'harvest_source_title', 'value': 'Darus Test Harvest'}], 'resources': [{'cache_last_updated': None, 'cache_url': None, 'created': '2023-05-08T19:13:37.642416', 'format': 'HTML', 'hash': '', 'id': 'd6bfe87a-4992-4c42-8965-dc6141fe8428', 'last_modified': None, 'metadata_modified': '2023-05-08T19:13:37.627995', 'mimetype': None, 'mimetype_inner': None, 'name': 'Data related to "Preferential interaction of DNMT3A subunits containing the R882H cancer mutation leads to dominant changes of flanking sequence effects"', 'package_id': 'doi-10-18419-darus-2231', 'position': 0, 'resource_type': 'HTML', 'size': None, 'state': 'active', 'url': 'https://doi.org/10.18419/darus-2231', 'url_type': None}], 'tags': [{'display_name': 'chemistry', 'id': '20e4e978-2a22-4286-a18b-4ae22d1ffca1', 'name': 'chemistry', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dna-methylation', 'id': 'e7346e2a-6a27-4ef7-9a8a-67d86bc040c4', 'name': 'dna-methylation', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dna-methyltransferase', 'id': '535aedd5-dcf4-4470-90a5-ab689b1b456e', 'name': 'dna-methyltransferase', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dna-sequences-after-hairpin-ligation-and-bisulfite-conversion', 'id': '33e68726-8dbf-424a-b07f-92860bc8116f', 'name': 'dna-sequences-after-hairpin-ligation-and-bisulfite-conversion', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dnmt3a', 'id': '1ce1eeaf-6ac8-4fb0-9456-fbd33ca8c0a9', 'name': 'dnmt3a', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'enzyme-assay', 'id': 'f4d04af7-98e2-455a-a8ec-5ae1aab87681', 'name': 'enzyme-assay', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'medicine-health-and-life-sciences', 'id': 'fb4c5813-8e73-46a1-ba71-17094769b523', 'name': 'medicine-health-and-life-sciences', 'state': 'active', 'vocabulary_id': None}], 'groups': [], 'relationships_as_subject': [], 'relationships_as_object': []}, {'author': 'Jeltsch, Albert, Bashtrykov, Pavel, Adam, Sabrina, Kunert, Stefan', 'author_email': None, 'creator_user_id': '1be646ae-ab26-47b8-8835-e4b27f11961e', 'id': 'doi-10-18419-darus-1781', 'isopen': False, 'license_id': '', 'license_title': '', 'maintainer': 'DaRUS', 'maintainer_email': None, 'metadata_created': '2023-05-08T19:13:12.421098', 'metadata_modified': '2023-05-08T19:13:12.421106', 'name': 'doi-10-18419-darus-1781', 'notes': 'Methylation of substrate libraries<br>\nSingle-stranded DNA oligonucleotides used for generation of double stranded substrates with different distance between CpG sites were obtained from IDT. Sixteen single-stranded oligonucleotides were pooled in equimolar amounts and the second strand synthesis was conducted by a primer extension reaction using one universal primer. The obtained mix of double-stranded DNA oligonucleotides was methylated by DNMT3A catalytic domain and DNMT3A/3L and incubated for 60 min at 37 °C in the presence of 0.8 mM S-adenosyl-L-methionine (Sigma) in reaction buffer (20 mM HEPES pH 7.5, 1 mM EDTA, 50 mM KCl, 0.05 mg/mL bovine serum albumin). For DNMT3A, concentrations of 0.25 µM, 0,5 µM, 1 µM and 2 µM were used, for DNMT3A/3L 0.125 µM and 0.25 µM. In addition, a no-enzyme control was processed identically to all other samples. Reactions were stopped by shock freezing in liquid nitrogen, then treated with proteinase K for 2 hours at 42 °C. Afterwards DNA was digested with BsaI-HFv2 enzyme and a hairpin (pGAGAAGGGATGTGGATACACATCCCT) was ligated using T4 DNA ligase (NEB). DNA was bisulfite converted using EZ DNA Methylation-Lightning kit (ZYMO RESEARCH) according to the manufacturer protocol, purified and eluted with 10 µL ddH2O.<br><br>\n\nNGS library generation<br>\nLibraries for Illumina Next Generation Sequencing (NGS) were produced with the two-step PCR approach. In the first PCR, 2 µL of bisulfite-converted DNA were amplified with the HotStartTaq DNA Polymerase (QIAGEN) and primers containing internal barcodes using following conditions: 15 min at 95 °C, 10 cycles of 30 sec at 94 °C, 30 sec at 50 °C, 1 min and 30 sec at 72 °C, and final 5 min at 72 °C; using a mixture containing 1x PCR Buffer, 1x Q-Solution, 0.2 mM dNTPs, 0.05 U/µL HotStartTaq DNA Polymerase, 0.4 µM forward and 0.4 µM reverse primers in a total volume of 20 µL. In the second PCR, 1 µL of obtained products were amplified by Phusion Polymerase (Thermo) with another set of primers to introduce adapters and indices needed for NGS (30 sec at 98 °C, 10 cycles - 10 sec at 98 °C, 40 sec at 72 °C, and 5 min at 72 °C). PCRII was carried out in 1x Phusion HF Buffer, 0.2 mM dNTPs, 0.02 U/µL Phusion HF DNA Polymerase, 0.4 µM forward and 0.4 µM reverse primers in a total volume of 20 µL. Obtained libraries were pooled in equimolar amounts, purified and sequenced in the Max Planck Genome Centre Cologne.<br><br>\n\nBioinformatic analysis<br>\nBioinformatic analysis of obtained NGS data was conducted with a local Galaxy server and with home written scripts. Briefly, fastq files were analyzed by FastQC, 3’ ends of the reads with a quality lower than 20 were trimmed and reads containing both full-length sense and antisense strands were selected. Next, the samples were split using the internal barcodes with respect to the different experimental conditions. Afterwards the insert DNA sequence was extracted and used for further downstream analysis. The uploaded text files contain the bisulfite converted sequences with pairs of CpG sites in variable distance as described in the furhter documentation (info.pdf).', 'num_resources': 1, 'num_tags': 10, 'organization': {'id': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'name': 'darus', 'title': 'DaRUS', 'type': 'repository', 'description': 'Chemistry collection from DaRUS, the data repository of the University of Stuttgart.', 'image_url': 'logoDarusKreis.png', 'created': '2023-05-03T09:01:04.791551', 'is_organization': True, 'approval_status': 'approved', 'state': 'active'}, 'owner_org': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'private': False, 'related_molecule': [], 'state': 'active', 'title': 'Data related to "Structural and biochemical insight into the mechanism of dual CpG site binding and methylation by DNMT3A"', 'type': 'dataset', 'url': 'Bisulfite-seq DNA methylation analysis', 'extras': [{'key': 'contributor', 'value': 'Jeltsch, Albert'}, {'key': 'creator', 'value': 'Jeltsch, Albert'}, {'key': 'date', 'value': '2021-04-12T00:00:00'}, {'key': 'identifier', 'value': 'https://doi.org/10.18419/darus-1781'}, {'key': 'metadata_modified', 'value': '2022-11-29T01:00:04'}, {'key': 'set_spec', 'value': 'all'}, {'key': 'harvest_object_id', 'value': '82dc57f2-448f-40f0-b6c4-20df46edf1e7'}, {'key': 'harvest_source_id', 'value': '8ba5ef26-d024-46cd-8099-94f1e74e7a36'}, {'key': 'harvest_source_title', 'value': 'Darus Test Harvest'}], 'resources': [{'cache_last_updated': None, 'cache_url': None, 'created': '2023-05-08T19:13:12.423312', 'format': 'HTML', 'hash': '', 'id': 'bca3e433-3a6d-40ad-8c5f-36ef67a4538e', 'last_modified': None, 'metadata_modified': '2023-05-08T19:13:12.408629', 'mimetype': None, 'mimetype_inner': None, 'name': 'Data related to "Structural and biochemical insight into the mechanism of dual CpG site binding and methylation by DNMT3A"', 'package_id': 'doi-10-18419-darus-1781', 'position': 0, 'resource_type': 'HTML', 'size': None, 'state': 'active', 'url': 'https://doi.org/10.18419/darus-1781', 'url_type': None}], 'tags': [{'display_name': 'chemistry', 'id': '20e4e978-2a22-4286-a18b-4ae22d1ffca1', 'name': 'chemistry', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'co-methylation', 'id': '6b0d2026-099d-4406-9f1e-65108985c704', 'name': 'co-methylation', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dna-methylation', 'id': 'e7346e2a-6a27-4ef7-9a8a-67d86bc040c4', 'name': 'dna-methylation', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dna-methyltransferase', 'id': '535aedd5-dcf4-4470-90a5-ab689b1b456e', 'name': 'dna-methyltransferase', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dna-sequences-after-hairpin-ligation-and-bisulfite-conversion', 'id': '33e68726-8dbf-424a-b07f-92860bc8116f', 'name': 'dna-sequences-after-hairpin-ligation-and-bisulfite-conversion', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dnmt3a', 'id': '1ce1eeaf-6ac8-4fb0-9456-fbd33ca8c0a9', 'name': 'dnmt3a', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dnmt3l', 'id': '95a1171d-2745-4af6-b00a-9d95803a3ce8', 'name': 'dnmt3l', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'enzyme-assay', 'id': 'f4d04af7-98e2-455a-a8ec-5ae1aab87681', 'name': 'enzyme-assay', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'medicine-health-and-life-sciences', 'id': 'fb4c5813-8e73-46a1-ba71-17094769b523', 'name': 'medicine-health-and-life-sciences', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'ngs-bisulfite-sequencing', 'id': '13051ab0-0f55-4da6-9725-55108bf87ee1', 'name': 'ngs-bisulfite-sequencing', 'state': 'active', 'vocabulary_id': None}], 'groups': [], 'relationships_as_subject': [], 'relationships_as_object': []}, {'author': 'Jeltsch, Albert, Bashtrykov, Pavel, Bröhm, Alexander, Dukatz, Michael, Adam, Sabrina', 'author_email': None, 'creator_user_id': '1be646ae-ab26-47b8-8835-e4b27f11961e', 'id': 'doi-10-18419-darus-1252', 'isopen': False, 'language': 'English', 'license_id': '', 'license_title': '', 'maintainer': 'DaRUS', 'maintainer_email': None, 'metadata_created': '2023-05-08T19:12:18.866702', 'metadata_modified': '2023-05-08T19:12:18.866707', 'name': 'doi-10-18419-darus-1252', 'notes': '<p>Methylation experiments:<br> \nFor the competitive nucleosome methylation experiments, 0.6 pmol of each nucleosome variant were digested with MluI (NEB) for 60 min at 37°C in 10 µL NEB Cutsmart buffer (50 mM KOAc/20 mM Tris-acetate pH 7.9, 10 mM Magnesium Acetate, 100 µg/mL BSA) to remove residual unbound DNA. Afterwards, DNMT3A2 or DNMT3AC was added to the mixture to a final concentration ranging from 0.5 µM to 3 µM and in 80 µL NEB Cutsmart buffer supplemented with 10 mM EDTA and 25 µM AdoMet (Perkin Elmer). The methylation reaction was allowed to proceed for 2 h at 37°C. To stop the reaction and remove all nucleosome-bound proteins, proteinase K was added to the reaction and the sample was incubated for further 60 min at 37°C. The resulting unbound DNA was purified from the reaction mixture using the Nucleospin Gel and PCR cleanup kit (Macherey-Nagel). Bisulfite conversion of the methylated DNA was performed using the EZ DNA Methylation-Lightning kit (Zymo Research). Methylation of free DNA was conducted the same way using 15 µM DNA.</p>\n\n<p>Library preparation and sequencing analysis: <br>\nSample-specific barcodes and indices were added to the DNA by PCR amplification in a two-step PCR process. Briefly, in the first PCR, barcoded primers were used to amplify the bisulfite converted nucleosome DNA using the HotStartTaq Polymerase (Qiagen) and the resulting 321 bp fragment was purified using the Nucleospin Gel and PCR cleanup kit (Macherey-Nagel). In the second PCR step, adaptors and indices required for sequencing were added by amplification with the respective primers and the Phusion polymerase (ThermoFisher). The final 390-bp product was purified and used for Illumina paired end 2x250 bp sequencing. Datasets were analyzed using a local instance of the Galaxy bioinformatics server. Sequence reads were trimmed with the Trim Galore! Tool (developed by Felix Krueger at the Babraham Institute) and subsequently paired using PEAR. The reads were filtered according to the expected DNA length using the Filter FASTQ tool and mapped to the corresponding reference sequence using bwameth to determine the percentage of methylated CpGs.</p>\n\nThe naming of the files is described in the Supplemental Table 1 of the accompanying manuscript.', 'num_resources': 1, 'num_tags': 11, 'organization': {'id': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'name': 'darus', 'title': 'DaRUS', 'type': 'repository', 'description': 'Chemistry collection from DaRUS, the data repository of the University of Stuttgart.', 'image_url': 'logoDarusKreis.png', 'created': '2023-05-03T09:01:04.791551', 'is_organization': True, 'approval_status': 'approved', 'state': 'active'}, 'owner_org': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'private': False, 'related_molecule': [], 'state': 'active', 'title': 'NGS data related to Bröhm et al.: Methylation of recombinant mononucleosomes by DNMT3A demonstrates efficient linker DNA methylation and a role of H3K36me3', 'type': 'dataset', 'url': 'Bisulfite-seq DNA methylation analysis', 'extras': [{'key': 'contributor', 'value': 'Jeltsch, Albert'}, {'key': 'creator', 'value': 'Jeltsch, Albert'}, {'key': 'date', 'value': '2021-01-26T00:00:00'}, {'key': 'identifier', 'value': 'https://doi.org/10.18419/darus-1252'}, {'key': 'metadata_modified', 'value': '2022-11-29T01:00:03'}, {'key': 'set_spec', 'value': 'all'}, {'key': 'harvest_object_id', 'value': '9c67c448-757f-42a9-8e75-d628b27b607f'}, {'key': 'harvest_source_id', 'value': '8ba5ef26-d024-46cd-8099-94f1e74e7a36'}, {'key': 'harvest_source_title', 'value': 'Darus Test Harvest'}], 'resources': [{'cache_last_updated': None, 'cache_url': None, 'created': '2023-05-08T19:12:18.904606', 'format': 'HTML', 'hash': '', 'id': '81932d4c-ba3b-4647-888a-e382236af3ef', 'last_modified': None, 'metadata_modified': '2023-05-08T19:12:18.852806', 'mimetype': None, 'mimetype_inner': None, 'name': 'NGS data related to Bröhm et al.: Methylation of recombinant mononucleosomes by DNMT3A demonstrates efficient linker DNA methylation and a role of H3K36me3', 'package_id': 'doi-10-18419-darus-1252', 'position': 0, 'resource_type': 'HTML', 'size': None, 'state': 'active', 'url': 'https://doi.org/10.18419/darus-1252', 'url_type': None}], 'tags': [{'display_name': 'bisulfite-sequencing', 'id': 'cc9cbc1b-80c9-46c0-bfa3-e6f82923eb72', 'name': 'bisulfite-sequencing', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'chemistry', 'id': '20e4e978-2a22-4286-a18b-4ae22d1ffca1', 'name': 'chemistry', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dna-methylation', 'id': 'e7346e2a-6a27-4ef7-9a8a-67d86bc040c4', 'name': 'dna-methylation', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dna-methyltransferase', 'id': '535aedd5-dcf4-4470-90a5-ab689b1b456e', 'name': 'dna-methyltransferase', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dnmt3a', 'id': '1ce1eeaf-6ac8-4fb0-9456-fbd33ca8c0a9', 'name': 'dnmt3a', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'enzyme-assay', 'id': 'f4d04af7-98e2-455a-a8ec-5ae1aab87681', 'name': 'enzyme-assay', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'h3k36me3', 'id': 'af9778ad-0c94-4f5e-b2a6-069aa5fc5143', 'name': 'h3k36me3', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'medicine-health-and-life-sciences', 'id': 'fb4c5813-8e73-46a1-ba71-17094769b523', 'name': 'medicine-health-and-life-sciences', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'ngs-bisulfite-sequencing', 'id': '13051ab0-0f55-4da6-9725-55108bf87ee1', 'name': 'ngs-bisulfite-sequencing', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'nucleosome', 'id': '72b78fb8-b32d-4411-9f81-ef8cde132ae7', 'name': 'nucleosome', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'raw-dna-sequences-in-fastqsanger-format', 'id': '690b0510-4dfe-487d-89b3-878664cbb4d8', 'name': 'raw-dna-sequences-in-fastqsanger-format', 'state': 'active', 'vocabulary_id': None}], 'groups': [], 'relationships_as_subject': [], 'relationships_as_object': []}] |
request |
<Request 'https://ckanchem21.service.tib.eu/dataset/?tags=chemistry&tags=enzyme-assay&tags=dna-methyltransferase' [GET]> |
session |
{'_domain': None, '_path': '/', '_accessed_time': 1750505570.6717637, '_creation_time': 1750505570.6717637, 'initial_search_params': {'facet.field': ['organization', 'measurement_technique', 'tags', 'license_id'], 'fq': ['tags:"chemistry" tags:"enzyme-assay" tags:"dna-methyltransferase" +dataset_type:dataset -dataset_type:harvest', '+site_id:"default"', '+state:active', '+permission_labels:("public")'], 'q': '*:*', 'rows': 21, 'start': 0, 'df': 'text', 'mm': '5<-4 9<-90%', 'defType': 'edismax', 'bf': '0', 'qf': 'title^5 text', 'sort': 'score desc, metadata_modified desc', 'fl': 'id validated_data_dict', 'facet': 'true', 'facet.limit': '50', 'facet.mincount': 1, 'wt': 'json', 'tie': '0.1', 'q.op': 'AND', 'extras': {}}, 'search_results_final': {'count': 5, 'facets': {'organization': {'darus': 5}, 'measurement_technique': {}, 'tags': {'chemistry': 5, 'dna-methylation': 5, 'dna-methyltransferase': 5, 'enzyme-assay': 5, 'medicine-health-and-life-sciences': 5, 'dnmt3a': 4, 'ngs-bisulfite-sequencing': 3, 'bisulfite-sequencing': 2, 'dna-sequences-after-hairpin-ligation-and-bisulfite-conversion': 2, 'raw-dna-sequences-in-fastqsanger-format': 2, 'co-methylation': 1, 'dnmt1': 1, 'dnmt3l': 1, 'enzyme-specificity': 1, 'h3k36me3': 1, 'nucleosome': 1, 'raw-dna-sequences-extracted-from-fastq-ngs-files-bisulfite-seq-of-5mc-analysis': 1}, 'license_id': {'': 5}}, 'results': [{'author': 'Jeltsch, Albert, Bashtrykov, Pavel, Adam, Sabrina', 'author_email': None, 'creator_user_id': '1be646ae-ab26-47b8-8835-e4b27f11961e', 'id': 'doi-10-18419-darus-3334', 'isopen': False, 'language': 'English', 'license_id': '', 'license_title': '', 'maintainer': 'DaRUS', 'maintainer_email': None, 'metadata_created': '2023-05-08T19:14:12.861674', 'metadata_modified': '2023-05-08T19:14:12.861682', 'name': 'doi-10-18419-darus-3334', 'notes': '<b>Expression and purification of DNMT1 for biochemical work</b><br>\nFull length murine DNMT1 (UniProtKB <a href="https://www.uniprot.org/uniprot/P13864">P13864</a>) was overexpressed and purified as described (Adam, et al. 2020) using the Bac-to-Bac baculovirus expression system (Invitrogen). The expression construct of the DNMT1 with mutated CXXC domain was taken from Bashtrykov, et al. (2012).<br>\n\n<b>Synthesis long DNA substrate and methylation reactions with them</b><br>\nThe sequence of the 349 bp substrate with 44 CpG sites was taken from Adam et al. 2020. It was used in unmethylated and hemimethylated form. Generation of the substrates and the methylation reaction were conducted as described (Adam, et al. 2020). In brief, for the generation of hemimethylated substrates, the unmethylated DNA was methylated in vitro by M.SssI (purified as described in Adam, et al. 2020) to introduce methylation at all CpG sites, or by M.HhaI (NEB) together with M.MspI (NEB) to introduce methylation at GCGC and CCGG sites. For the synthesis of hemimethylated substrates, the upper strand of the methylated substrate was digested with lambda exonuclease, the ss-DNA purified and finally ds hemimethylated DNA was generated by by primer extension using Phusion® HF DNA Polymerase (Thermo). Methylation reaction were conducted using mixtures of UM, fully hemimethylated and patterned substrate (total DNA concentration 200 ng in 20 µL) in methylation buffer (100 mM HEPES, 1 mM EDTA, 0.5 mM DTT, 0.1 mg mL-1 BSA, pH 7.2 with KOH) containing 1 mM AdoMet. DNMT1 concentrations and incubation times are indicated in the text. Methylation was followed by bisulfite conversion using the EZ DNA Methylation-LightningTM Kit (ZYMO RESEARCH) followed by library generation and Illumina paired-end sequencing (Novogene).<br>\n\n<b>Flanking sequence preference analysis with randomized single-site substrates</b><br>\nMethylation reactions of the randomized substrate with DNMT1 were performed similarly as described (Adam, et al. 2020; Gao, et al. 2020). Briefly, single-stranded oligonucleotides containing a methylated, hydroxymethylated or unmethylated CpG site embedded in a 10 nucleotide random context were obtained from IDT and used for generation of 67 bps long double-stranded DNA substrates by primer extension. Pools of these randomized substrates were then mixed in different combination, methylated by DNMT1 in methylation buffer (100 mM HEPES, 1 mM EDTA, 0.5 mM DTT, 0.1 mg mL-1 BSA, pH 7.2 with KOH) containing 1 mM AdoMet. DNMT1 concentrations and incubation times are indicated in the text. Methylation was followed by bisulfite conversion using the EZ DNA Methylation-LightningTM Kit (ZYMO RESEARCH) followed by library generation and Illumina paired-end sequencing (Novogene).<br>\n\n<b>Bioinformatics analysis</b><br>\nNGS data sets were bioinformatically analyzed using a local instance of the Galaxy server as described (Adam, et al. 2020; Dukatz, et al. 2020; Dukatz, et al. 2022). In brief, for the long substrate, reads were trimmed, filtered by quality, mapped against the reference sequence and demultiplexed using substrate type and experiment specific barcodes. Afterwards, methylation information was assigned and retrieved by home-made skripts. For the randomized substrate, reads were trimmed and filtered according to the expected DNA size. The original DNA sequence was then reconstituted based on the bisulfite converted upper and lower strands to investigate the average methylation state of both CpG sites and the NNCGNN flanks using home-made skripts. Methylation rates of 256 NNCGNN sequence contexts in the competitive methylation experiments with the mixed single-site substrates were determined by fitting to monoexponential reaction progress curves with variable time points with MatLab skripts as described (Adam, et al. 2022). Pearson correlation factors were calculated with Excel using the correl function.<br>\n\n<b>Structure of the deposited data</b><br>\nMethylation data of long substrates are placed in the “long DNA substrates” folder. Methylation data of short single-site substrates with randomized flanks are placed in the “single sites substrates” folder. In both folder an explanatory pdf file gives further information. Subfolders are arranged by enzyme (CXXC mutant or DNMT1 WT). Then, for each enzyme, the different substrates or substrate mixtures are provided in separate subfolders.<br>\n\n<b>References</b><br>\n<li>Adam S, Bräcker J, Klingel V, Osteresch B, Radde NE, Brockmeyer J, Bashtrykov P, Jeltsch A. Flanking sequences influence the activity of TET1 and TET2 methylcytosine dioxygenases and affect genomic 5hmC patterns. Communications Biology 5, 92 (2022)\n<li>Adam S, Anteneh H, Hornisch M, Wagner V, Lu J, Radde NE, Bashtrykov P, Song J, Jeltsch A. DNA sequence-dependent activity and base flipping mechanisms of DNMT1 regulate genome-wide DNA methylation. Nature Commun 11, 3723 (2020)\n<li>Bashtrykov P, et al. Specificity of Dnmt1 for methylation of hemimethylated CpG sites resides in its catalytic domain. Chem Biol 19, 572-578 (2012)\n<li>Dukatz M, Dittrich M, Stahl E, Adam S, de Mendoza A, Bashtrykov P, Jeltsch A. DNA methyltransferase DNMT3A forms interaction networks with the CpG site and flanking sequence elements for efficient methylation. J. Biol. Chem. 298(10), 102462 (2022)\n<li>Dukatz M, Adam S, Biswal M, Song J, Bashtrykov P, Jeltsch A. Complex DNA sequence readout mechanisms of the DNMT3B DNA methyltransferase. Nucleic Acids Res 48, 11495-11509 (2020)\n<li>Gao L, Emperle M, Guo Y, Grimm SA, Ren W, Adam S, Uryu H, Zhang ZM, Chen D, Yin J, Dukatz M, Anteneh H, Jurkowska RZ, Lu J, Wang Y, Bashtrykov P, Wade PA, Wang GG, Jeltsch A, Song J. Comprehensive Structure-Function Characterization of DNMT3B and DNMT3A Reveals Distinctive De Novo DNA Methylation Mechanisms. Nature Commun 11, 3355 (2020)\n<br><br>\n<b>Data set 1</b> contains the combined methylation rates of all 256 NNCGNN sequences in HM, OH and UM context by DNMT1, as well as their corresponding standard error of the mean (SEM) values. For details how these numbers were determined refer to the description in the corresponding publication.', 'num_resources': 1, 'num_tags': 8, 'organization': {'id': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'name': 'darus', 'title': 'DaRUS', 'type': 'repository', 'description': 'Chemistry collection from DaRUS, the data repository of the University of Stuttgart.', 'image_url': 'logoDarusKreis.png', 'created': '2023-05-03T09:01:04.791551', 'is_organization': True, 'approval_status': 'approved', 'state': 'active'}, 'owner_org': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'private': False, 'related_molecule': [], 'state': 'active', 'title': 'NGS data related to Adam et al.: On the accuracy of the epigenetic copy machine - comprehensive specificity analysis of the DNMT1 DNA methyltransferase', 'type': 'dataset', 'extras': [{'key': 'contributor', 'value': 'Jeltsch, Albert'}, {'key': 'creator', 'value': 'Jeltsch, Albert'}, {'key': 'date', 'value': '2023-04-04T00:00:00'}, {'key': 'identifier', 'value': 'https://doi.org/10.18419/darus-3334'}, {'key': 'metadata_modified', 'value': '2023-04-28T00:00:05'}, {'key': 'set_spec', 'value': 'all'}, {'key': 'harvest_object_id', 'value': '1d155cce-62c5-4d8f-86d7-eb3768892c4d'}, {'key': 'harvest_source_id', 'value': '8ba5ef26-d024-46cd-8099-94f1e74e7a36'}, {'key': 'harvest_source_title', 'value': 'Darus Test Harvest'}], 'resources': [{'cache_last_updated': None, 'cache_url': None, 'created': '2023-05-08T19:14:12.863643', 'format': 'HTML', 'hash': '', 'id': '51461cc1-1b40-41bc-b7f9-7f0efe0f67c5', 'last_modified': None, 'metadata_modified': '2023-05-08T19:14:12.830220', 'mimetype': None, 'mimetype_inner': None, 'name': 'NGS data related to Adam et al.: On the accuracy of the epigenetic copy machine - comprehensive specificity analysis of the DNMT1 DNA methyltransferase', 'package_id': 'doi-10-18419-darus-3334', 'position': 0, 'resource_type': 'HTML', 'size': None, 'state': 'active', 'url': 'https://doi.org/10.18419/darus-3334', 'url_type': None}], 'tags': [{'display_name': 'chemistry', 'id': '20e4e978-2a22-4286-a18b-4ae22d1ffca1', 'name': 'chemistry', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dna-methylation', 'id': 'e7346e2a-6a27-4ef7-9a8a-67d86bc040c4', 'name': 'dna-methylation', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dna-methyltransferase', 'id': '535aedd5-dcf4-4470-90a5-ab689b1b456e', 'name': 'dna-methyltransferase', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dnmt1', 'id': 'c2bc85f9-cd83-41a3-bb3d-d00f697ff0ad', 'name': 'dnmt1', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'enzyme-assay', 'id': 'f4d04af7-98e2-455a-a8ec-5ae1aab87681', 'name': 'enzyme-assay', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'enzyme-specificity', 'id': 'a9460414-cc78-4daa-aa69-952291b72087', 'name': 'enzyme-specificity', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'medicine-health-and-life-sciences', 'id': 'fb4c5813-8e73-46a1-ba71-17094769b523', 'name': 'medicine-health-and-life-sciences', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'raw-dna-sequences-extracted-from-fastq-ngs-files-bisulfite-seq-of-5mc-analysis', 'id': '926440e2-39e5-4f03-9eb2-2cc6387f2f2c', 'name': 'raw-dna-sequences-extracted-from-fastq-ngs-files-bisulfite-seq-of-5mc-analysis', 'state': 'active', 'vocabulary_id': None}], 'groups': [], 'relationships_as_subject': [], 'relationships_as_object': []}, {'author': 'Jeltsch, Albert, Bashtrykov, Pavel, Dukatz, Michael, Adam, Sabrina', 'author_email': None, 'creator_user_id': '1be646ae-ab26-47b8-8835-e4b27f11961e', 'id': 'doi-10-18419-darus-2993', 'isopen': False, 'language': 'English', 'license_id': '', 'license_title': '', 'maintainer': 'DaRUS', 'maintainer_email': None, 'metadata_created': '2023-05-08T19:13:56.226018', 'metadata_modified': '2023-05-08T19:13:56.226023', 'name': 'doi-10-18419-darus-2993', 'notes': 'The naming of the files is described in the Supplemental Tables 1 of the accompanying manuscript.', 'num_resources': 1, 'num_tags': 9, 'organization': {'id': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'name': 'darus', 'title': 'DaRUS', 'type': 'repository', 'description': 'Chemistry collection from DaRUS, the data repository of the University of Stuttgart.', 'image_url': 'logoDarusKreis.png', 'created': '2023-05-03T09:01:04.791551', 'is_organization': True, 'approval_status': 'approved', 'state': 'active'}, 'owner_org': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'private': False, 'related_molecule': [], 'state': 'active', 'title': 'NGS data related to Dukatz et al.: DNA methyltransferase DNMT3A forms interaction networks with the CpG site and flanking sequence elements for efficient methylation', 'type': 'dataset', 'url': 'Bisulfite-seq DNA methylation analysis', 'extras': [{'key': 'contributor', 'value': 'Jeltsch, Albert'}, {'key': 'creator', 'value': 'Jeltsch, Albert'}, {'key': 'date', 'value': '2022-09-27T00:00:00'}, {'key': 'identifier', 'value': 'https://doi.org/10.18419/darus-2993'}, {'key': 'metadata_modified', 'value': '2022-11-29T01:00:05'}, {'key': 'set_spec', 'value': 'all'}, {'key': 'harvest_object_id', 'value': '058d1346-3f8c-4576-a756-218403628fd1'}, {'key': 'harvest_source_id', 'value': '8ba5ef26-d024-46cd-8099-94f1e74e7a36'}, {'key': 'harvest_source_title', 'value': 'Darus Test Harvest'}], 'resources': [{'cache_last_updated': None, 'cache_url': None, 'created': '2023-05-08T19:13:56.227703', 'format': 'HTML', 'hash': '', 'id': '7f8432f4-9256-4b79-b50f-5904435a0e7b', 'last_modified': None, 'metadata_modified': '2023-05-08T19:13:56.212450', 'mimetype': None, 'mimetype_inner': None, 'name': 'NGS data related to Dukatz et al.: DNA methyltransferase DNMT3A forms interaction networks with the CpG site and flanking sequence elements for efficient methylation', 'package_id': 'doi-10-18419-darus-2993', 'position': 0, 'resource_type': 'HTML', 'size': None, 'state': 'active', 'url': 'https://doi.org/10.18419/darus-2993', 'url_type': None}], 'tags': [{'display_name': 'bisulfite-sequencing', 'id': 'cc9cbc1b-80c9-46c0-bfa3-e6f82923eb72', 'name': 'bisulfite-sequencing', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'chemistry', 'id': '20e4e978-2a22-4286-a18b-4ae22d1ffca1', 'name': 'chemistry', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dna-methylation', 'id': 'e7346e2a-6a27-4ef7-9a8a-67d86bc040c4', 'name': 'dna-methylation', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dna-methyltransferase', 'id': '535aedd5-dcf4-4470-90a5-ab689b1b456e', 'name': 'dna-methyltransferase', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dnmt3a', 'id': '1ce1eeaf-6ac8-4fb0-9456-fbd33ca8c0a9', 'name': 'dnmt3a', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'enzyme-assay', 'id': 'f4d04af7-98e2-455a-a8ec-5ae1aab87681', 'name': 'enzyme-assay', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'medicine-health-and-life-sciences', 'id': 'fb4c5813-8e73-46a1-ba71-17094769b523', 'name': 'medicine-health-and-life-sciences', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'ngs-bisulfite-sequencing', 'id': '13051ab0-0f55-4da6-9725-55108bf87ee1', 'name': 'ngs-bisulfite-sequencing', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'raw-dna-sequences-in-fastqsanger-format', 'id': '690b0510-4dfe-487d-89b3-878664cbb4d8', 'name': 'raw-dna-sequences-in-fastqsanger-format', 'state': 'active', 'vocabulary_id': None}], 'groups': [], 'relationships_as_subject': [], 'relationships_as_object': []}, {'author': 'Jeltsch, Albert, Bashtrykov, Pavel, Adam, Sabrina, Mack, Alexandra, Emperle, Max', 'author_email': None, 'creator_user_id': '1be646ae-ab26-47b8-8835-e4b27f11961e', 'id': 'doi-10-18419-darus-2231', 'isopen': False, 'license_id': '', 'license_title': '', 'maintainer': 'DaRUS', 'maintainer_email': None, 'metadata_created': '2023-05-08T19:13:37.638623', 'metadata_modified': '2023-05-08T19:13:37.638628', 'name': 'doi-10-18419-darus-2231', 'notes': '<p>Methylation of substrate libraries<br>\nSingle-stranded DNA oligonucleotides used for generation of double stranded substrates with a distance of 12 base pairs between CpG sites were obtained from IDT. Second strand synthesis was conducted by a primer extension reaction using one universal primer. The obtained library of double-stranded DNA oligonucleotides was methylated by different purified heterotetramers containing DNMT3A catalytic domain and DNMT3A R882H catalytic domain subunit, boht either containing a His-tag or MBD-tag. For this it was incubated for 60 min at 37 °C in the presence of 0.8 mM S-adenosyl-L-methionine (Sigma) in reaction buffer (20 mM HEPES pH 7.5, 1 mM EDTA, 50 mM KCl, 0.05 mg/mL bovine serum albumin). DNA concentrations were 107 nM, DNMT3A concentrations were used between 0.05 and 0.1 µM. Reactions were stopped by shock freezing in liquid nitrogen, then treated with proteinase K for 2 hours at 42 °C. Afterwards DNA was digested with BsaI-HFv2 enzyme and a hairpin (pGAGAAGGGATGTGGATACACATCCCT) was ligated using T4 DNA ligase (NEB). DNA was bisulfite converted using EZ DNA Methylation-Lightning kit (ZYMO RESEARCH) according to the manufacturer protocol, purified and eluted with 10 µL ddH2O.</p>\n\n<p>NGS library generation<br>\nLibraries for Illumina Next Generation Sequencing (NGS) were produced with the two-step PCR approach. In the first PCR, 2 µL of bisulfite-converted DNA were amplified with the HotStartTaq DNA Polymerase (QIAGEN) and primers containing internal barcodes using following conditions: 15 min at 95 °C, 10 cycles of 30 sec at 94 °C, 30 sec at 50 °C, 1 min and 30 sec at 72 °C, and final 5 min at 72 °C; using a mixture containing 1x PCR Buffer, 1x Q-Solution, 0.2 mM dNTPs, 0.05 U/µL HotStartTaq DNA Polymerase, 0.4 µM forward and 0.4 µM reverse primers in a total volume of 20 µL. In the second PCR, 1 µL of obtained products were amplified by Phusion Polymerase (Thermo) with another set of primers to introduce adapters and indices needed for NGS (30 sec at 98 °C, 10 cycles - 10 sec at 98 °C, 40 sec at 72 °C, and 5 min at 72 °C). PCRII was carried out in 1x Phusion HF Buffer, 0.2 mM dNTPs, 0.02 U/µL Phusion HF DNA Polymerase, 0.4 µM forward and 0.4 µM reverse primers in a total volume of 20 µL. Obtained libraries were pooled in equimolar amounts, purified and sequenced in the Max Planck Genome Centre Cologne.</p>\n\n<p>Bioinformatic analysis<br>\nBioinformatic analysis of obtained NGS data was conducted with a local Galaxy server and with home written scripts. Briefly, fastq files were analyzed by FastQC, 3’ ends of the reads with a quality lower than 20 were trimmed and reads containing both full-length sense and antisense strands were selected. Next, the samples were split using the internal barcodes with respect to the different experimental conditions. Afterwards the insert DNA sequence was extracted and used for further downstream analysis. The uploaded text files contain the bisulfite converted sequences with pairs of CpG sites in 12 bp distance as described in the furhter documentation (info.pdf).</p>\n\nThe naming of the files is as follows:<br>\nName, Complex, Repeat, c(DNMT3AC) [µM]<br>\n1WW, His-WT/MBP-WT, R1, 0.1<br>\n2WW, His-WT/MBP-WT, R2, 0.05<br>\n1RR, His-R882H/MBP-R882H, R1, 0.1<br>\n2RR, His-R882H/MBP-R882H, R2, 0.07<br>\n1RW, His-R882H/MBP-WT, R1, 0.1<br>\n2RW, His-R882H/MBP-WT, R2, 0.1<br>\n1WR, His-WT/MBP-R882H, R1, 0.1<br>\n2WR, His-WT/MBP-R882H, R2, 0.1<br>', 'num_resources': 1, 'num_tags': 7, 'organization': {'id': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'name': 'darus', 'title': 'DaRUS', 'type': 'repository', 'description': 'Chemistry collection from DaRUS, the data repository of the University of Stuttgart.', 'image_url': 'logoDarusKreis.png', 'created': '2023-05-03T09:01:04.791551', 'is_organization': True, 'approval_status': 'approved', 'state': 'active'}, 'owner_org': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'private': False, 'related_molecule': [], 'state': 'active', 'title': 'Data related to "Preferential interaction of DNMT3A subunits containing the R882H cancer mutation leads to dominant changes of flanking sequence effects"', 'type': 'dataset', 'url': 'Bisulfite-seq DNA methylation analysis', 'extras': [{'key': 'contributor', 'value': 'Jeltsch, Albert'}, {'key': 'creator', 'value': 'Jeltsch, Albert'}, {'key': 'date', 'value': '2021-11-11T00:00:00'}, {'key': 'identifier', 'value': 'https://doi.org/10.18419/darus-2231'}, {'key': 'metadata_modified', 'value': '2022-11-29T01:00:04'}, {'key': 'relation', 'value': 'Jeltsch, Albert; Bashtrykov, Pavel; Adam, Sabrina; Kunert, Stefan: Data related to "Structural and biochemical insight into the mechanism of dual CpG site binding and methylation by DNMT3A. \nDOI: <a href="https://doi.org/10.18419/darus-1781">10.18419/darus-1781</a>'}, {'key': 'set_spec', 'value': 'all'}, {'key': 'harvest_object_id', 'value': '1b040aab-70bf-4f4e-890d-82448acb4453'}, {'key': 'harvest_source_id', 'value': '8ba5ef26-d024-46cd-8099-94f1e74e7a36'}, {'key': 'harvest_source_title', 'value': 'Darus Test Harvest'}], 'resources': [{'cache_last_updated': None, 'cache_url': None, 'created': '2023-05-08T19:13:37.642416', 'format': 'HTML', 'hash': '', 'id': 'd6bfe87a-4992-4c42-8965-dc6141fe8428', 'last_modified': None, 'metadata_modified': '2023-05-08T19:13:37.627995', 'mimetype': None, 'mimetype_inner': None, 'name': 'Data related to "Preferential interaction of DNMT3A subunits containing the R882H cancer mutation leads to dominant changes of flanking sequence effects"', 'package_id': 'doi-10-18419-darus-2231', 'position': 0, 'resource_type': 'HTML', 'size': None, 'state': 'active', 'url': 'https://doi.org/10.18419/darus-2231', 'url_type': None}], 'tags': [{'display_name': 'chemistry', 'id': '20e4e978-2a22-4286-a18b-4ae22d1ffca1', 'name': 'chemistry', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dna-methylation', 'id': 'e7346e2a-6a27-4ef7-9a8a-67d86bc040c4', 'name': 'dna-methylation', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dna-methyltransferase', 'id': '535aedd5-dcf4-4470-90a5-ab689b1b456e', 'name': 'dna-methyltransferase', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dna-sequences-after-hairpin-ligation-and-bisulfite-conversion', 'id': '33e68726-8dbf-424a-b07f-92860bc8116f', 'name': 'dna-sequences-after-hairpin-ligation-and-bisulfite-conversion', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dnmt3a', 'id': '1ce1eeaf-6ac8-4fb0-9456-fbd33ca8c0a9', 'name': 'dnmt3a', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'enzyme-assay', 'id': 'f4d04af7-98e2-455a-a8ec-5ae1aab87681', 'name': 'enzyme-assay', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'medicine-health-and-life-sciences', 'id': 'fb4c5813-8e73-46a1-ba71-17094769b523', 'name': 'medicine-health-and-life-sciences', 'state': 'active', 'vocabulary_id': None}], 'groups': [], 'relationships_as_subject': [], 'relationships_as_object': []}, {'author': 'Jeltsch, Albert, Bashtrykov, Pavel, Adam, Sabrina, Kunert, Stefan', 'author_email': None, 'creator_user_id': '1be646ae-ab26-47b8-8835-e4b27f11961e', 'id': 'doi-10-18419-darus-1781', 'isopen': False, 'license_id': '', 'license_title': '', 'maintainer': 'DaRUS', 'maintainer_email': None, 'metadata_created': '2023-05-08T19:13:12.421098', 'metadata_modified': '2023-05-08T19:13:12.421106', 'name': 'doi-10-18419-darus-1781', 'notes': 'Methylation of substrate libraries<br>\nSingle-stranded DNA oligonucleotides used for generation of double stranded substrates with different distance between CpG sites were obtained from IDT. Sixteen single-stranded oligonucleotides were pooled in equimolar amounts and the second strand synthesis was conducted by a primer extension reaction using one universal primer. The obtained mix of double-stranded DNA oligonucleotides was methylated by DNMT3A catalytic domain and DNMT3A/3L and incubated for 60 min at 37 °C in the presence of 0.8 mM S-adenosyl-L-methionine (Sigma) in reaction buffer (20 mM HEPES pH 7.5, 1 mM EDTA, 50 mM KCl, 0.05 mg/mL bovine serum albumin). For DNMT3A, concentrations of 0.25 µM, 0,5 µM, 1 µM and 2 µM were used, for DNMT3A/3L 0.125 µM and 0.25 µM. In addition, a no-enzyme control was processed identically to all other samples. Reactions were stopped by shock freezing in liquid nitrogen, then treated with proteinase K for 2 hours at 42 °C. Afterwards DNA was digested with BsaI-HFv2 enzyme and a hairpin (pGAGAAGGGATGTGGATACACATCCCT) was ligated using T4 DNA ligase (NEB). DNA was bisulfite converted using EZ DNA Methylation-Lightning kit (ZYMO RESEARCH) according to the manufacturer protocol, purified and eluted with 10 µL ddH2O.<br><br>\n\nNGS library generation<br>\nLibraries for Illumina Next Generation Sequencing (NGS) were produced with the two-step PCR approach. In the first PCR, 2 µL of bisulfite-converted DNA were amplified with the HotStartTaq DNA Polymerase (QIAGEN) and primers containing internal barcodes using following conditions: 15 min at 95 °C, 10 cycles of 30 sec at 94 °C, 30 sec at 50 °C, 1 min and 30 sec at 72 °C, and final 5 min at 72 °C; using a mixture containing 1x PCR Buffer, 1x Q-Solution, 0.2 mM dNTPs, 0.05 U/µL HotStartTaq DNA Polymerase, 0.4 µM forward and 0.4 µM reverse primers in a total volume of 20 µL. In the second PCR, 1 µL of obtained products were amplified by Phusion Polymerase (Thermo) with another set of primers to introduce adapters and indices needed for NGS (30 sec at 98 °C, 10 cycles - 10 sec at 98 °C, 40 sec at 72 °C, and 5 min at 72 °C). PCRII was carried out in 1x Phusion HF Buffer, 0.2 mM dNTPs, 0.02 U/µL Phusion HF DNA Polymerase, 0.4 µM forward and 0.4 µM reverse primers in a total volume of 20 µL. Obtained libraries were pooled in equimolar amounts, purified and sequenced in the Max Planck Genome Centre Cologne.<br><br>\n\nBioinformatic analysis<br>\nBioinformatic analysis of obtained NGS data was conducted with a local Galaxy server and with home written scripts. Briefly, fastq files were analyzed by FastQC, 3’ ends of the reads with a quality lower than 20 were trimmed and reads containing both full-length sense and antisense strands were selected. Next, the samples were split using the internal barcodes with respect to the different experimental conditions. Afterwards the insert DNA sequence was extracted and used for further downstream analysis. The uploaded text files contain the bisulfite converted sequences with pairs of CpG sites in variable distance as described in the furhter documentation (info.pdf).', 'num_resources': 1, 'num_tags': 10, 'organization': {'id': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'name': 'darus', 'title': 'DaRUS', 'type': 'repository', 'description': 'Chemistry collection from DaRUS, the data repository of the University of Stuttgart.', 'image_url': 'logoDarusKreis.png', 'created': '2023-05-03T09:01:04.791551', 'is_organization': True, 'approval_status': 'approved', 'state': 'active'}, 'owner_org': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'private': False, 'related_molecule': [], 'state': 'active', 'title': 'Data related to "Structural and biochemical insight into the mechanism of dual CpG site binding and methylation by DNMT3A"', 'type': 'dataset', 'url': 'Bisulfite-seq DNA methylation analysis', 'extras': [{'key': 'contributor', 'value': 'Jeltsch, Albert'}, {'key': 'creator', 'value': 'Jeltsch, Albert'}, {'key': 'date', 'value': '2021-04-12T00:00:00'}, {'key': 'identifier', 'value': 'https://doi.org/10.18419/darus-1781'}, {'key': 'metadata_modified', 'value': '2022-11-29T01:00:04'}, {'key': 'set_spec', 'value': 'all'}, {'key': 'harvest_object_id', 'value': '82dc57f2-448f-40f0-b6c4-20df46edf1e7'}, {'key': 'harvest_source_id', 'value': '8ba5ef26-d024-46cd-8099-94f1e74e7a36'}, {'key': 'harvest_source_title', 'value': 'Darus Test Harvest'}], 'resources': [{'cache_last_updated': None, 'cache_url': None, 'created': '2023-05-08T19:13:12.423312', 'format': 'HTML', 'hash': '', 'id': 'bca3e433-3a6d-40ad-8c5f-36ef67a4538e', 'last_modified': None, 'metadata_modified': '2023-05-08T19:13:12.408629', 'mimetype': None, 'mimetype_inner': None, 'name': 'Data related to "Structural and biochemical insight into the mechanism of dual CpG site binding and methylation by DNMT3A"', 'package_id': 'doi-10-18419-darus-1781', 'position': 0, 'resource_type': 'HTML', 'size': None, 'state': 'active', 'url': 'https://doi.org/10.18419/darus-1781', 'url_type': None}], 'tags': [{'display_name': 'chemistry', 'id': '20e4e978-2a22-4286-a18b-4ae22d1ffca1', 'name': 'chemistry', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'co-methylation', 'id': '6b0d2026-099d-4406-9f1e-65108985c704', 'name': 'co-methylation', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dna-methylation', 'id': 'e7346e2a-6a27-4ef7-9a8a-67d86bc040c4', 'name': 'dna-methylation', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dna-methyltransferase', 'id': '535aedd5-dcf4-4470-90a5-ab689b1b456e', 'name': 'dna-methyltransferase', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dna-sequences-after-hairpin-ligation-and-bisulfite-conversion', 'id': '33e68726-8dbf-424a-b07f-92860bc8116f', 'name': 'dna-sequences-after-hairpin-ligation-and-bisulfite-conversion', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dnmt3a', 'id': '1ce1eeaf-6ac8-4fb0-9456-fbd33ca8c0a9', 'name': 'dnmt3a', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dnmt3l', 'id': '95a1171d-2745-4af6-b00a-9d95803a3ce8', 'name': 'dnmt3l', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'enzyme-assay', 'id': 'f4d04af7-98e2-455a-a8ec-5ae1aab87681', 'name': 'enzyme-assay', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'medicine-health-and-life-sciences', 'id': 'fb4c5813-8e73-46a1-ba71-17094769b523', 'name': 'medicine-health-and-life-sciences', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'ngs-bisulfite-sequencing', 'id': '13051ab0-0f55-4da6-9725-55108bf87ee1', 'name': 'ngs-bisulfite-sequencing', 'state': 'active', 'vocabulary_id': None}], 'groups': [], 'relationships_as_subject': [], 'relationships_as_object': []}, {'author': 'Jeltsch, Albert, Bashtrykov, Pavel, Bröhm, Alexander, Dukatz, Michael, Adam, Sabrina', 'author_email': None, 'creator_user_id': '1be646ae-ab26-47b8-8835-e4b27f11961e', 'id': 'doi-10-18419-darus-1252', 'isopen': False, 'language': 'English', 'license_id': '', 'license_title': '', 'maintainer': 'DaRUS', 'maintainer_email': None, 'metadata_created': '2023-05-08T19:12:18.866702', 'metadata_modified': '2023-05-08T19:12:18.866707', 'name': 'doi-10-18419-darus-1252', 'notes': '<p>Methylation experiments:<br> \nFor the competitive nucleosome methylation experiments, 0.6 pmol of each nucleosome variant were digested with MluI (NEB) for 60 min at 37°C in 10 µL NEB Cutsmart buffer (50 mM KOAc/20 mM Tris-acetate pH 7.9, 10 mM Magnesium Acetate, 100 µg/mL BSA) to remove residual unbound DNA. Afterwards, DNMT3A2 or DNMT3AC was added to the mixture to a final concentration ranging from 0.5 µM to 3 µM and in 80 µL NEB Cutsmart buffer supplemented with 10 mM EDTA and 25 µM AdoMet (Perkin Elmer). The methylation reaction was allowed to proceed for 2 h at 37°C. To stop the reaction and remove all nucleosome-bound proteins, proteinase K was added to the reaction and the sample was incubated for further 60 min at 37°C. The resulting unbound DNA was purified from the reaction mixture using the Nucleospin Gel and PCR cleanup kit (Macherey-Nagel). Bisulfite conversion of the methylated DNA was performed using the EZ DNA Methylation-Lightning kit (Zymo Research). Methylation of free DNA was conducted the same way using 15 µM DNA.</p>\n\n<p>Library preparation and sequencing analysis: <br>\nSample-specific barcodes and indices were added to the DNA by PCR amplification in a two-step PCR process. Briefly, in the first PCR, barcoded primers were used to amplify the bisulfite converted nucleosome DNA using the HotStartTaq Polymerase (Qiagen) and the resulting 321 bp fragment was purified using the Nucleospin Gel and PCR cleanup kit (Macherey-Nagel). In the second PCR step, adaptors and indices required for sequencing were added by amplification with the respective primers and the Phusion polymerase (ThermoFisher). The final 390-bp product was purified and used for Illumina paired end 2x250 bp sequencing. Datasets were analyzed using a local instance of the Galaxy bioinformatics server. Sequence reads were trimmed with the Trim Galore! Tool (developed by Felix Krueger at the Babraham Institute) and subsequently paired using PEAR. The reads were filtered according to the expected DNA length using the Filter FASTQ tool and mapped to the corresponding reference sequence using bwameth to determine the percentage of methylated CpGs.</p>\n\nThe naming of the files is described in the Supplemental Table 1 of the accompanying manuscript.', 'num_resources': 1, 'num_tags': 11, 'organization': {'id': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'name': 'darus', 'title': 'DaRUS', 'type': 'repository', 'description': 'Chemistry collection from DaRUS, the data repository of the University of Stuttgart.', 'image_url': 'logoDarusKreis.png', 'created': '2023-05-03T09:01:04.791551', 'is_organization': True, 'approval_status': 'approved', 'state': 'active'}, 'owner_org': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'private': False, 'related_molecule': [], 'state': 'active', 'title': 'NGS data related to Bröhm et al.: Methylation of recombinant mononucleosomes by DNMT3A demonstrates efficient linker DNA methylation and a role of H3K36me3', 'type': 'dataset', 'url': 'Bisulfite-seq DNA methylation analysis', 'extras': [{'key': 'contributor', 'value': 'Jeltsch, Albert'}, {'key': 'creator', 'value': 'Jeltsch, Albert'}, {'key': 'date', 'value': '2021-01-26T00:00:00'}, {'key': 'identifier', 'value': 'https://doi.org/10.18419/darus-1252'}, {'key': 'metadata_modified', 'value': '2022-11-29T01:00:03'}, {'key': 'set_spec', 'value': 'all'}, {'key': 'harvest_object_id', 'value': '9c67c448-757f-42a9-8e75-d628b27b607f'}, {'key': 'harvest_source_id', 'value': '8ba5ef26-d024-46cd-8099-94f1e74e7a36'}, {'key': 'harvest_source_title', 'value': 'Darus Test Harvest'}], 'resources': [{'cache_last_updated': None, 'cache_url': None, 'created': '2023-05-08T19:12:18.904606', 'format': 'HTML', 'hash': '', 'id': '81932d4c-ba3b-4647-888a-e382236af3ef', 'last_modified': None, 'metadata_modified': '2023-05-08T19:12:18.852806', 'mimetype': None, 'mimetype_inner': None, 'name': 'NGS data related to Bröhm et al.: Methylation of recombinant mononucleosomes by DNMT3A demonstrates efficient linker DNA methylation and a role of H3K36me3', 'package_id': 'doi-10-18419-darus-1252', 'position': 0, 'resource_type': 'HTML', 'size': None, 'state': 'active', 'url': 'https://doi.org/10.18419/darus-1252', 'url_type': None}], 'tags': [{'display_name': 'bisulfite-sequencing', 'id': 'cc9cbc1b-80c9-46c0-bfa3-e6f82923eb72', 'name': 'bisulfite-sequencing', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'chemistry', 'id': '20e4e978-2a22-4286-a18b-4ae22d1ffca1', 'name': 'chemistry', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dna-methylation', 'id': 'e7346e2a-6a27-4ef7-9a8a-67d86bc040c4', 'name': 'dna-methylation', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dna-methyltransferase', 'id': '535aedd5-dcf4-4470-90a5-ab689b1b456e', 'name': 'dna-methyltransferase', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dnmt3a', 'id': '1ce1eeaf-6ac8-4fb0-9456-fbd33ca8c0a9', 'name': 'dnmt3a', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'enzyme-assay', 'id': 'f4d04af7-98e2-455a-a8ec-5ae1aab87681', 'name': 'enzyme-assay', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'h3k36me3', 'id': 'af9778ad-0c94-4f5e-b2a6-069aa5fc5143', 'name': 'h3k36me3', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'medicine-health-and-life-sciences', 'id': 'fb4c5813-8e73-46a1-ba71-17094769b523', 'name': 'medicine-health-and-life-sciences', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'ngs-bisulfite-sequencing', 'id': '13051ab0-0f55-4da6-9725-55108bf87ee1', 'name': 'ngs-bisulfite-sequencing', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'nucleosome', 'id': '72b78fb8-b32d-4411-9f81-ef8cde132ae7', 'name': 'nucleosome', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'raw-dna-sequences-in-fastqsanger-format', 'id': '690b0510-4dfe-487d-89b3-878664cbb4d8', 'name': 'raw-dna-sequences-in-fastqsanger-format', 'state': 'active', 'vocabulary_id': None}], 'groups': [], 'relationships_as_subject': [], 'relationships_as_object': []}], 'sort': 'score desc, metadata_modified desc', 'search_facets': {'organization': {'title': 'organization', 'items': [{'name': 'darus', 'display_name': 'DaRUS', 'count': 5}]}, 'measurement_technique': {'title': 'measurement_technique', 'items': []}, 'tags': {'title': 'tags', 'items': [{'name': 'raw-dna-sequences-in-fastqsanger-format', 'display_name': 'raw-dna-sequences-in-fastqsanger-format', 'count': 2}, {'name': 'raw-dna-sequences-extracted-from-fastq-ngs-files-bisulfite-seq-of-5mc-analysis', 'display_name': 'raw-dna-sequences-extracted-from-fastq-ngs-files-bisulfite-seq-of-5mc-analysis', 'count': 1}, {'name': 'nucleosome', 'display_name': 'nucleosome', 'count': 1}, {'name': 'ngs-bisulfite-sequencing', 'display_name': 'ngs-bisulfite-sequencing', 'count': 3}, {'name': 'medicine-health-and-life-sciences', 'display_name': 'medicine-health-and-life-sciences', 'count': 5}, {'name': 'h3k36me3', 'display_name': 'h3k36me3', 'count': 1}, {'name': 'enzyme-specificity', 'display_name': 'enzyme-specificity', 'count': 1}, {'name': 'enzyme-assay', 'display_name': 'enzyme-assay', 'count': 5}, {'name': 'dnmt3l', 'display_name': 'dnmt3l', 'count': 1}, {'name': 'dnmt3a', 'display_name': 'dnmt3a', 'count': 4}, {'name': 'dnmt1', 'display_name': 'dnmt1', 'count': 1}, {'name': 'dna-sequences-after-hairpin-ligation-and-bisulfite-conversion', 'display_name': 'dna-sequences-after-hairpin-ligation-and-bisulfite-conversion', 'count': 2}, {'name': 'dna-methyltransferase', 'display_name': 'dna-methyltransferase', 'count': 5}, {'name': 'dna-methylation', 'display_name': 'dna-methylation', 'count': 5}, {'name': 'co-methylation', 'display_name': 'co-methylation', 'count': 1}, {'name': 'chemistry', 'display_name': 'chemistry', 'count': 5}, {'name': 'bisulfite-sequencing', 'display_name': 'bisulfite-sequencing', 'count': 2}]}, 'license_id': {'title': 'license_id', 'items': [{'name': '', 'display_name': '', 'count': 5}]}}}, 'search_params': None} |
ungettext |
<function ungettext at 0x7f0d1e2eb1e0> |