| session |
{'_domain': None, '_path': '/', '_accessed_time': 1750612262.8219454, '_creation_time': 1750612262.8219454, 'initial_search_params': {'facet.field': ['organization', 'measurement_technique', 'tags', 'license_id'], 'fq': ['tags:"medicine-health-and-life-sciences" +dataset_type:dataset -dataset_type:harvest', '+site_id:"default"', '+state:active', '+permission_labels:("public")'], 'q': '*:*', 'rows': 21, 'start': 0, 'df': 'text', 'mm': '5<-4 9<-90%', 'defType': 'edismax', 'bf': '0', 'qf': 'title^5 text', 'sort': 'score desc, metadata_modified desc', 'fl': 'id validated_data_dict', 'facet': 'true', 'facet.limit': '50', 'facet.mincount': 1, 'wt': 'json', 'tie': '0.1', 'q.op': 'AND', 'extras': {}}, 'search_results_final': {'count': 15, 'facets': {'organization': {'darus': 15}, 'measurement_technique': {}, 'tags': {'chemistry': 15, 'medicine-health-and-life-sciences': 15, 'dna-methylation': 5, 'dna-methyltransferase': 5, 'enzyme-assay': 5, 'biotechnology': 4, 'dnmt3a': 4, 'enzymeml': 4, 'enzymology': 4, 'ngs-bisulfite-sequencing': 3, 'bisulfite-sequencing': 2, 'computer-and-information-science': 2, 'dna-sequences-after-hairpin-ligation-and-bisulfite-conversion': 2, 'enzyme-specificity': 2, 'raw-dna-sequences-in-fastqsanger-format': 2, 'biocatalysis': 1, 'co-methylation': 1, 'desulfurase': 1, 'dnmt1': 1, 'dnmt3l': 1, 'droplet-interface-bilayers': 1, 'engineering': 1, 'h3k36me3': 1, 'ion-channel': 1, 'kinetic-model': 1, 'kinetic-modeling': 1, 'lateral-membrane-protein-diffusion': 1, 'md-simulations-analysis-python-scripts': 1, 'md-simulations-python-scripts': 1, 'mitochondria': 1, 'molecular-models-of-protein-structures': 1, 'nucleosome': 1, 'physics': 1, 'primary-data-tables': 1, 'protein-methyltransferases': 1, 'quorum-quenching-microbiology': 1, 'quorum-sensing-microbiology': 1, 'raw-dna-sequences-extracted-from-fastq-ngs-files-bisulfite-seq-of-5mc-analysis': 1, 'sbgn': 1, 'single-molecule-tirf-microscopy': 1, 'systems-biology': 1, 'systems-biology-graphical-notation': 1, 'tom-complex': 1, 'videos': 1, 'web-databases': 1}, 'license_id': {'': 15}}, 'results': [{'author': 'Jeltsch, Albert, Bashtrykov, Pavel, Adam, Sabrina', 'author_email': None, 'creator_user_id': '1be646ae-ab26-47b8-8835-e4b27f11961e', 'id': 'doi-10-18419-darus-3334', 'isopen': False, 'language': 'English', 'license_id': '', 'license_title': '', 'maintainer': 'DaRUS', 'maintainer_email': None, 'metadata_created': '2023-05-08T19:14:12.861674', 'metadata_modified': '2023-05-08T19:14:12.861682', 'name': 'doi-10-18419-darus-3334', 'notes': '<b>Expression and purification of DNMT1 for biochemical work</b><br>\nFull length murine DNMT1 (UniProtKB <a href="https://www.uniprot.org/uniprot/P13864">P13864</a>) was overexpressed and purified as described (Adam, et al. 2020) using the Bac-to-Bac baculovirus expression system (Invitrogen). The expression construct of the DNMT1 with mutated CXXC domain was taken from Bashtrykov, et al. (2012).<br>\n\n<b>Synthesis long DNA substrate and methylation reactions with them</b><br>\nThe sequence of the 349 bp substrate with 44 CpG sites was taken from Adam et al. 2020. It was used in unmethylated and hemimethylated form. Generation of the substrates and the methylation reaction were conducted as described (Adam, et al. 2020). In brief, for the generation of hemimethylated substrates, the unmethylated DNA was methylated in vitro by M.SssI (purified as described in Adam, et al. 2020) to introduce methylation at all CpG sites, or by M.HhaI (NEB) together with M.MspI (NEB) to introduce methylation at GCGC and CCGG sites. For the synthesis of hemimethylated substrates, the upper strand of the methylated substrate was digested with lambda exonuclease, the ss-DNA purified and finally ds hemimethylated DNA was generated by by primer extension using Phusion® HF DNA Polymerase (Thermo). Methylation reaction were conducted using mixtures of UM, fully hemimethylated and patterned substrate (total DNA concentration 200 ng in 20 µL) in methylation buffer (100 mM HEPES, 1 mM EDTA, 0.5 mM DTT, 0.1 mg mL-1 BSA, pH 7.2 with KOH) containing 1 mM AdoMet. DNMT1 concentrations and incubation times are indicated in the text. Methylation was followed by bisulfite conversion using the EZ DNA Methylation-LightningTM Kit (ZYMO RESEARCH) followed by library generation and Illumina paired-end sequencing (Novogene).<br>\n\n<b>Flanking sequence preference analysis with randomized single-site substrates</b><br>\nMethylation reactions of the randomized substrate with DNMT1 were performed similarly as described (Adam, et al. 2020; Gao, et al. 2020). Briefly, single-stranded oligonucleotides containing a methylated, hydroxymethylated or unmethylated CpG site embedded in a 10 nucleotide random context were obtained from IDT and used for generation of 67 bps long double-stranded DNA substrates by primer extension. Pools of these randomized substrates were then mixed in different combination, methylated by DNMT1 in methylation buffer (100 mM HEPES, 1 mM EDTA, 0.5 mM DTT, 0.1 mg mL-1 BSA, pH 7.2 with KOH) containing 1 mM AdoMet. DNMT1 concentrations and incubation times are indicated in the text. Methylation was followed by bisulfite conversion using the EZ DNA Methylation-LightningTM Kit (ZYMO RESEARCH) followed by library generation and Illumina paired-end sequencing (Novogene).<br>\n\n<b>Bioinformatics analysis</b><br>\nNGS data sets were bioinformatically analyzed using a local instance of the Galaxy server as described (Adam, et al. 2020; Dukatz, et al. 2020; Dukatz, et al. 2022). In brief, for the long substrate, reads were trimmed, filtered by quality, mapped against the reference sequence and demultiplexed using substrate type and experiment specific barcodes. Afterwards, methylation information was assigned and retrieved by home-made skripts. For the randomized substrate, reads were trimmed and filtered according to the expected DNA size. The original DNA sequence was then reconstituted based on the bisulfite converted upper and lower strands to investigate the average methylation state of both CpG sites and the NNCGNN flanks using home-made skripts. Methylation rates of 256 NNCGNN sequence contexts in the competitive methylation experiments with the mixed single-site substrates were determined by fitting to monoexponential reaction progress curves with variable time points with MatLab skripts as described (Adam, et al. 2022). Pearson correlation factors were calculated with Excel using the correl function.<br>\n\n<b>Structure of the deposited data</b><br>\nMethylation data of long substrates are placed in the “long DNA substrates” folder. Methylation data of short single-site substrates with randomized flanks are placed in the “single sites substrates” folder. In both folder an explanatory pdf file gives further information. Subfolders are arranged by enzyme (CXXC mutant or DNMT1 WT). Then, for each enzyme, the different substrates or substrate mixtures are provided in separate subfolders.<br>\n\n<b>References</b><br>\n<li>Adam S, Bräcker J, Klingel V, Osteresch B, Radde NE, Brockmeyer J, Bashtrykov P, Jeltsch A. Flanking sequences influence the activity of TET1 and TET2 methylcytosine dioxygenases and affect genomic 5hmC patterns. Communications Biology 5, 92 (2022)\n<li>Adam S, Anteneh H, Hornisch M, Wagner V, Lu J, Radde NE, Bashtrykov P, Song J, Jeltsch A. DNA sequence-dependent activity and base flipping mechanisms of DNMT1 regulate genome-wide DNA methylation. Nature Commun 11, 3723 (2020)\n<li>Bashtrykov P, et al. Specificity of Dnmt1 for methylation of hemimethylated CpG sites resides in its catalytic domain. Chem Biol 19, 572-578 (2012)\n<li>Dukatz M, Dittrich M, Stahl E, Adam S, de Mendoza A, Bashtrykov P, Jeltsch A. DNA methyltransferase DNMT3A forms interaction networks with the CpG site and flanking sequence elements for efficient methylation. J. Biol. Chem. 298(10), 102462 (2022)\n<li>Dukatz M, Adam S, Biswal M, Song J, Bashtrykov P, Jeltsch A. Complex DNA sequence readout mechanisms of the DNMT3B DNA methyltransferase. Nucleic Acids Res 48, 11495-11509 (2020)\n<li>Gao L, Emperle M, Guo Y, Grimm SA, Ren W, Adam S, Uryu H, Zhang ZM, Chen D, Yin J, Dukatz M, Anteneh H, Jurkowska RZ, Lu J, Wang Y, Bashtrykov P, Wade PA, Wang GG, Jeltsch A, Song J. Comprehensive Structure-Function Characterization of DNMT3B and DNMT3A Reveals Distinctive De Novo DNA Methylation Mechanisms. Nature Commun 11, 3355 (2020)\n<br><br>\n<b>Data set 1</b> contains the combined methylation rates of all 256 NNCGNN sequences in HM, OH and UM context by DNMT1, as well as their corresponding standard error of the mean (SEM) values. For details how these numbers were determined refer to the description in the corresponding publication.', 'num_resources': 1, 'num_tags': 8, 'organization': {'id': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'name': 'darus', 'title': 'DaRUS', 'type': 'repository', 'description': 'Chemistry collection from DaRUS, the data repository of the University of Stuttgart.', 'image_url': 'logoDarusKreis.png', 'created': '2023-05-03T09:01:04.791551', 'is_organization': True, 'approval_status': 'approved', 'state': 'active'}, 'owner_org': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'private': False, 'related_molecule': [], 'state': 'active', 'title': 'NGS data related to Adam et al.: On the accuracy of the epigenetic copy machine - comprehensive specificity analysis of the DNMT1 DNA methyltransferase', 'type': 'dataset', 'extras': [{'key': 'contributor', 'value': 'Jeltsch, Albert'}, {'key': 'creator', 'value': 'Jeltsch, Albert'}, {'key': 'date', 'value': '2023-04-04T00:00:00'}, {'key': 'identifier', 'value': 'https://doi.org/10.18419/darus-3334'}, {'key': 'metadata_modified', 'value': '2023-04-28T00:00:05'}, {'key': 'set_spec', 'value': 'all'}, {'key': 'harvest_object_id', 'value': '1d155cce-62c5-4d8f-86d7-eb3768892c4d'}, {'key': 'harvest_source_id', 'value': '8ba5ef26-d024-46cd-8099-94f1e74e7a36'}, {'key': 'harvest_source_title', 'value': 'Darus Test Harvest'}], 'resources': [{'cache_last_updated': None, 'cache_url': None, 'created': '2023-05-08T19:14:12.863643', 'format': 'HTML', 'hash': '', 'id': '51461cc1-1b40-41bc-b7f9-7f0efe0f67c5', 'last_modified': None, 'metadata_modified': '2023-05-08T19:14:12.830220', 'mimetype': None, 'mimetype_inner': None, 'name': 'NGS data related to Adam et al.: On the accuracy of the epigenetic copy machine - comprehensive specificity analysis of the DNMT1 DNA methyltransferase', 'package_id': 'doi-10-18419-darus-3334', 'position': 0, 'resource_type': 'HTML', 'size': None, 'state': 'active', 'url': 'https://doi.org/10.18419/darus-3334', 'url_type': None}], 'tags': [{'display_name': 'chemistry', 'id': '20e4e978-2a22-4286-a18b-4ae22d1ffca1', 'name': 'chemistry', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dna-methylation', 'id': 'e7346e2a-6a27-4ef7-9a8a-67d86bc040c4', 'name': 'dna-methylation', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dna-methyltransferase', 'id': '535aedd5-dcf4-4470-90a5-ab689b1b456e', 'name': 'dna-methyltransferase', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dnmt1', 'id': 'c2bc85f9-cd83-41a3-bb3d-d00f697ff0ad', 'name': 'dnmt1', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'enzyme-assay', 'id': 'f4d04af7-98e2-455a-a8ec-5ae1aab87681', 'name': 'enzyme-assay', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'enzyme-specificity', 'id': 'a9460414-cc78-4daa-aa69-952291b72087', 'name': 'enzyme-specificity', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'medicine-health-and-life-sciences', 'id': 'fb4c5813-8e73-46a1-ba71-17094769b523', 'name': 'medicine-health-and-life-sciences', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'raw-dna-sequences-extracted-from-fastq-ngs-files-bisulfite-seq-of-5mc-analysis', 'id': '926440e2-39e5-4f03-9eb2-2cc6387f2f2c', 'name': 'raw-dna-sequences-extracted-from-fastq-ngs-files-bisulfite-seq-of-5mc-analysis', 'state': 'active', 'vocabulary_id': None}], 'groups': [], 'relationships_as_subject': [], 'relationships_as_object': []}, {'author': 'Jeltsch, Albert, Schnee, Philipp, Saad, Mina, Weirich, Sara, Pleiss, Jürgen, Bashtrykov, Pavel', 'author_email': None, 'creator_user_id': '1be646ae-ab26-47b8-8835-e4b27f11961e', 'id': 'doi-10-18419-darus-3263', 'isopen': False, 'language': 'English', 'license_id': '', 'license_title': '', 'maintainer': 'DaRUS', 'maintainer_email': None, 'metadata_created': '2023-05-08T19:14:08.163193', 'metadata_modified': '2023-05-08T19:14:08.163199', 'name': 'doi-10-18419-darus-3263', 'notes': 'This data collection contains additional data related to Khellaet al.: "The T1150A cancer mutant of the protein lysine methyltransferase NSD2 can introduce H3K36 trimethylation". \nThis includes <BR><ul>\n\n<li>Movie 1: Example of a successful docking of AdoMet to the NSD2 T1150A - H3K36me2 peptide complex</li>\n<li>Modelled structures of NSD2 bound to different peptides and cofactors\n<li>Source data of the results of the MD analysis</li>\n<li>MD simulations codes and analysis scripts</li>\n<li>Supplementary Tables</li>\n</ul>', 'num_resources': 1, 'num_tags': 10, 'organization': {'id': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'name': 'darus', 'title': 'DaRUS', 'type': 'repository', 'description': 'Chemistry collection from DaRUS, the data repository of the University of Stuttgart.', 'image_url': 'logoDarusKreis.png', 'created': '2023-05-03T09:01:04.791551', 'is_organization': True, 'approval_status': 'approved', 'state': 'active'}, 'owner_org': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'private': False, 'related_molecule': [], 'state': 'active', 'title': 'Additional data related to Khella et al.: The T1150A cancer mutant of the protein lysine methyltransferase NSD2 can introduce H3K36 trimethylation', 'type': 'dataset', 'extras': [{'key': 'contributor', 'value': 'Jeltsch, Albert'}, {'key': 'creator', 'value': 'Jeltsch, Albert'}, {'key': 'date', 'value': '2023-03-14T00:00:00'}, {'key': 'identifier', 'value': 'https://doi.org/10.18419/darus-3263'}, {'key': 'metadata_modified', 'value': '2023-03-15T01:00:04'}, {'key': 'set_spec', 'value': 'all'}, {'key': 'harvest_object_id', 'value': '876f1931-c5e1-47b4-99c1-f13b48c833d4'}, {'key': 'harvest_source_id', 'value': '8ba5ef26-d024-46cd-8099-94f1e74e7a36'}, {'key': 'harvest_source_title', 'value': 'Darus Test Harvest'}], 'resources': [{'cache_last_updated': None, 'cache_url': None, 'created': '2023-05-08T19:14:08.175723', 'format': 'HTML', 'hash': '', 'id': '57219e49-91d2-4c08-a8e6-6ffc4dfd4fdd', 'last_modified': None, 'metadata_modified': '2023-05-08T19:14:08.150055', 'mimetype': None, 'mimetype_inner': None, 'name': 'Additional data related to Khella et al.: The T1150A cancer mutant of the protein lysine methyltransferase NSD2 can introduce H3K36 trimethylation', 'package_id': 'doi-10-18419-darus-3263', 'position': 0, 'resource_type': 'HTML', 'size': None, 'state': 'active', 'url': 'https://doi.org/10.18419/darus-3263', 'url_type': None}], 'tags': [{'display_name': 'chemistry', 'id': '20e4e978-2a22-4286-a18b-4ae22d1ffca1', 'name': 'chemistry', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'computer-and-information-science', 'id': '75b28b6d-af69-4c24-9c9e-451d429aad9b', 'name': 'computer-and-information-science', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'enzyme-specificity', 'id': 'a9460414-cc78-4daa-aa69-952291b72087', 'name': 'enzyme-specificity', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'md-simulations-analysis-python-scripts', 'id': '090ccb6e-3f9f-42e3-ba28-8eb84aae62b5', 'name': 'md-simulations-analysis-python-scripts', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'md-simulations-python-scripts', 'id': 'b9739d54-7835-4e4c-8fd2-5f85460281ea', 'name': 'md-simulations-python-scripts', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'medicine-health-and-life-sciences', 'id': 'fb4c5813-8e73-46a1-ba71-17094769b523', 'name': 'medicine-health-and-life-sciences', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'molecular-models-of-protein-structures', 'id': '1a839617-bec8-4193-bae8-fc5ba2c7ebb2', 'name': 'molecular-models-of-protein-structures', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'primary-data-tables', 'id': '0bb08af2-fd1c-47c4-b7d4-2400eb49780d', 'name': 'primary-data-tables', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'protein-methyltransferases', 'id': 'ac68d376-42e5-4c1f-b3d2-5811016c074b', 'name': 'protein-methyltransferases', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'videos', 'id': '30874e95-14cd-418c-ab1b-9c0b6160021e', 'name': 'videos', 'state': 'active', 'vocabulary_id': None}], 'groups': [], 'relationships_as_subject': [], 'relationships_as_object': []}, {'author': 'Klein, Karsten, Garkov, Dimitar, Rütschlin, Sina, Böttcher, Thomas, Schreiber, Falk', 'author_email': None, 'creator_user_id': '1be646ae-ab26-47b8-8835-e4b27f11961e', 'id': 'doi-10-18419-darus-3242', 'isopen': False, 'license_id': '', 'license_title': '', 'maintainer': 'DaRUS', 'maintainer_email': None, 'metadata_created': '2023-05-08T19:14:06.993704', 'metadata_modified': '2023-05-08T19:14:06.993710', 'name': 'doi-10-18419-darus-3242', 'notes': 'The add-on had been designed for the <a href="http:\\\\vanted.org">VANTED framework</a> and used to create QSDB Database\'s collection of clickable networks. Each network is laid out according to SBGN standards, showing quorum sensing and quorum quenching interactions between organisms and signaling molecules. This data set constitutes the source code of the add-on, developed to visualise the SBGN graphs of the QSDB Database using as input tabular aggregated data collected from existing literature.<br><br>\n\n<p><b>Paper abstract:</b> The human microbiome is largely shaped by the chemical interactions of its microbial members, which includes cross-talk via shared signals or quenching of the signalling of other species. Quorum sensing is a process that allows microbes to coordinate their behaviour in dependence of their population density and to adjust gene expression accordingly. We present the Quorum Sensing Database (QSDB), a comprehensive database of all published sensing and quenching relations between organisms and signalling molecules of the human microbiome, as well as an interactive web interface that allows browsing the database, provides graphical depictions of sensing mechanisms as Systems Biology Graphical Notation diagrams and links to other databases.<br><br>\n\n<b>Database URL:</b> QSDB (Quorum Sensing DataBase) is freely available via an interactive web interface and as a downloadable csv file at <a href="http://qsdb.org">http://qsdb.org</a>.</p>', 'num_resources': 1, 'num_tags': 9, 'organization': {'id': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'name': 'darus', 'title': 'DaRUS', 'type': 'repository', 'description': 'Chemistry collection from DaRUS, the data repository of the University of Stuttgart.', 'image_url': 'logoDarusKreis.png', 'created': '2023-05-03T09:01:04.791551', 'is_organization': True, 'approval_status': 'approved', 'state': 'active'}, 'owner_org': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'private': False, 'related_molecule': [], 'state': 'active', 'title': 'QSDB - a graphical Quorum Sensing Database: VANTED add-on source code', 'type': 'dataset', 'extras': [{'key': 'contributor', 'value': 'Garkov, Dimitar'}, {'key': 'creator', 'value': 'Klein, Karsten'}, {'key': 'date', 'value': '2022-11-21T00:00:00'}, {'key': 'identifier', 'value': 'https://doi.org/10.18419/darus-3242'}, {'key': 'metadata_modified', 'value': '2022-11-29T01:00:05'}, {'key': 'relation', 'value': 'The published produced data is available to access and download at: <a href="http:\\\\qsdb.org">http:\\\\qsdb.org</a>.'}, {'key': 'set_spec', 'value': 'all'}, {'key': 'harvest_object_id', 'value': '8e36537d-af4a-4146-a6d3-957026565d21'}, {'key': 'harvest_source_id', 'value': '8ba5ef26-d024-46cd-8099-94f1e74e7a36'}, {'key': 'harvest_source_title', 'value': 'Darus Test Harvest'}], 'resources': [{'cache_last_updated': None, 'cache_url': None, 'created': '2023-05-08T19:14:06.995355', 'format': 'HTML', 'hash': '', 'id': '051c0d01-9d0b-4ff2-a996-5159f2424844', 'last_modified': None, 'metadata_modified': '2023-05-08T19:14:06.981987', 'mimetype': None, 'mimetype_inner': None, 'name': 'QSDB - a graphical Quorum Sensing Database: VANTED add-on source code', 'package_id': 'doi-10-18419-darus-3242', 'position': 0, 'resource_type': 'HTML', 'size': None, 'state': 'active', 'url': 'https://doi.org/10.18419/darus-3242', 'url_type': None}], 'tags': [{'display_name': 'chemistry', 'id': '20e4e978-2a22-4286-a18b-4ae22d1ffca1', 'name': 'chemistry', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'computer-and-information-science', 'id': '75b28b6d-af69-4c24-9c9e-451d429aad9b', 'name': 'computer-and-information-science', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'medicine-health-and-life-sciences', 'id': 'fb4c5813-8e73-46a1-ba71-17094769b523', 'name': 'medicine-health-and-life-sciences', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'quorum-quenching-microbiology', 'id': '866a0576-b399-43cf-95fb-4e4f66ca52cb', 'name': 'quorum-quenching-microbiology', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'quorum-sensing-microbiology', 'id': '4bab2336-f29a-4339-8f2b-6861c9095719', 'name': 'quorum-sensing-microbiology', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'sbgn', 'id': '1a0ce8bf-2353-41e1-a90a-6e988685dfcc', 'name': 'sbgn', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'systems-biology', 'id': '4a3b851d-e9f3-4abc-9f33-390abbafb0e1', 'name': 'systems-biology', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'systems-biology-graphical-notation', 'id': '884f8189-b82c-4ac2-bfcb-ad9caae7e7d2', 'name': 'systems-biology-graphical-notation', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'web-databases', 'id': '2f4bb02f-e20d-4c23-9cb5-58bc87acbbdc', 'name': 'web-databases', 'state': 'active', 'vocabulary_id': None}], 'groups': [], 'relationships_as_subject': [], 'relationships_as_object': []}, {'author': 'Jeltsch, Albert, Bashtrykov, Pavel, Dukatz, Michael, Adam, Sabrina', 'author_email': None, 'creator_user_id': '1be646ae-ab26-47b8-8835-e4b27f11961e', 'id': 'doi-10-18419-darus-2993', 'isopen': False, 'language': 'English', 'license_id': '', 'license_title': '', 'maintainer': 'DaRUS', 'maintainer_email': None, 'metadata_created': '2023-05-08T19:13:56.226018', 'metadata_modified': '2023-05-08T19:13:56.226023', 'name': 'doi-10-18419-darus-2993', 'notes': 'The naming of the files is described in the Supplemental Tables 1 of the accompanying manuscript.', 'num_resources': 1, 'num_tags': 9, 'organization': {'id': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'name': 'darus', 'title': 'DaRUS', 'type': 'repository', 'description': 'Chemistry collection from DaRUS, the data repository of the University of Stuttgart.', 'image_url': 'logoDarusKreis.png', 'created': '2023-05-03T09:01:04.791551', 'is_organization': True, 'approval_status': 'approved', 'state': 'active'}, 'owner_org': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'private': False, 'related_molecule': [], 'state': 'active', 'title': 'NGS data related to Dukatz et al.: DNA methyltransferase DNMT3A forms interaction networks with the CpG site and flanking sequence elements for efficient methylation', 'type': 'dataset', 'url': 'Bisulfite-seq DNA methylation analysis', 'extras': [{'key': 'contributor', 'value': 'Jeltsch, Albert'}, {'key': 'creator', 'value': 'Jeltsch, Albert'}, {'key': 'date', 'value': '2022-09-27T00:00:00'}, {'key': 'identifier', 'value': 'https://doi.org/10.18419/darus-2993'}, {'key': 'metadata_modified', 'value': '2022-11-29T01:00:05'}, {'key': 'set_spec', 'value': 'all'}, {'key': 'harvest_object_id', 'value': '058d1346-3f8c-4576-a756-218403628fd1'}, {'key': 'harvest_source_id', 'value': '8ba5ef26-d024-46cd-8099-94f1e74e7a36'}, {'key': 'harvest_source_title', 'value': 'Darus Test Harvest'}], 'resources': [{'cache_last_updated': None, 'cache_url': None, 'created': '2023-05-08T19:13:56.227703', 'format': 'HTML', 'hash': '', 'id': '7f8432f4-9256-4b79-b50f-5904435a0e7b', 'last_modified': None, 'metadata_modified': '2023-05-08T19:13:56.212450', 'mimetype': None, 'mimetype_inner': None, 'name': 'NGS data related to Dukatz et al.: DNA methyltransferase DNMT3A forms interaction networks with the CpG site and flanking sequence elements for efficient methylation', 'package_id': 'doi-10-18419-darus-2993', 'position': 0, 'resource_type': 'HTML', 'size': None, 'state': 'active', 'url': 'https://doi.org/10.18419/darus-2993', 'url_type': None}], 'tags': [{'display_name': 'bisulfite-sequencing', 'id': 'cc9cbc1b-80c9-46c0-bfa3-e6f82923eb72', 'name': 'bisulfite-sequencing', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'chemistry', 'id': '20e4e978-2a22-4286-a18b-4ae22d1ffca1', 'name': 'chemistry', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dna-methylation', 'id': 'e7346e2a-6a27-4ef7-9a8a-67d86bc040c4', 'name': 'dna-methylation', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dna-methyltransferase', 'id': '535aedd5-dcf4-4470-90a5-ab689b1b456e', 'name': 'dna-methyltransferase', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dnmt3a', 'id': '1ce1eeaf-6ac8-4fb0-9456-fbd33ca8c0a9', 'name': 'dnmt3a', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'enzyme-assay', 'id': 'f4d04af7-98e2-455a-a8ec-5ae1aab87681', 'name': 'enzyme-assay', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'medicine-health-and-life-sciences', 'id': 'fb4c5813-8e73-46a1-ba71-17094769b523', 'name': 'medicine-health-and-life-sciences', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'ngs-bisulfite-sequencing', 'id': '13051ab0-0f55-4da6-9725-55108bf87ee1', 'name': 'ngs-bisulfite-sequencing', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'raw-dna-sequences-in-fastqsanger-format', 'id': '690b0510-4dfe-487d-89b3-878664cbb4d8', 'name': 'raw-dna-sequences-in-fastqsanger-format', 'state': 'active', 'vocabulary_id': None}], 'groups': [], 'relationships_as_subject': [], 'relationships_as_object': []}, {'author': 'Pinto, Maria Filipa', 'author_email': None, 'creator_user_id': '1be646ae-ab26-47b8-8835-e4b27f11961e', 'id': 'doi-10-18419-darus-2483', 'isopen': False, 'license_id': '', 'license_title': '', 'maintainer': 'DaRUS', 'maintainer_email': None, 'metadata_created': '2023-05-08T19:13:45.147555', 'metadata_modified': '2023-05-08T19:13:45.147561', 'name': 'doi-10-18419-darus-2483', 'notes': 'Measured was the reaction from cysteine to alanine by the Cysteine desulfurase, for six different initial concentrations of cysteine. The data consists of three data points over the course of 2.5 minutes for alanine. Additionally, the concentration of cysteine over time was calculated from the given values, for the later modelling.', 'num_resources': 1, 'num_tags': 8, 'organization': {'id': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'name': 'darus', 'title': 'DaRUS', 'type': 'repository', 'description': 'Chemistry collection from DaRUS, the data repository of the University of Stuttgart.', 'image_url': 'logoDarusKreis.png', 'created': '2023-05-03T09:01:04.791551', 'is_organization': True, 'approval_status': 'approved', 'state': 'active'}, 'owner_org': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'private': False, 'related_molecule': [], 'state': 'active', 'title': 'Catalysis of L-cysteine by IscS in the presence of IscU', 'type': 'dataset', 'extras': [{'key': 'creator', 'value': 'Pinto, Maria Filipa'}, {'key': 'date', 'value': '2022-02-15T00:00:00'}, {'key': 'identifier', 'value': 'https://doi.org/10.18419/darus-2483'}, {'key': 'metadata_modified', 'value': '2022-11-29T01:00:05'}, {'key': 'relation', 'value': 'Pinto, Maria Filipa. (2020). Catalysis of L-cysteine by IscS in the presence of IscU (dataset formatted for analysis by interferENZY) [Data set]. Zenodo. doi:<a href="https://doi.org/10.5281/zenodo.3957403">10.5281/zenodo.3957403</a>'}, {'key': 'set_spec', 'value': 'all'}, {'key': 'harvest_object_id', 'value': 'b04fb46b-da18-48a4-b0e5-940458dc5696'}, {'key': 'harvest_source_id', 'value': '8ba5ef26-d024-46cd-8099-94f1e74e7a36'}, {'key': 'harvest_source_title', 'value': 'Darus Test Harvest'}], 'resources': [{'cache_last_updated': None, 'cache_url': None, 'created': '2023-05-08T19:13:45.164417', 'format': 'HTML', 'hash': '', 'id': 'f5718555-0534-4637-a1eb-28868b051620', 'last_modified': None, 'metadata_modified': '2023-05-08T19:13:45.136387', 'mimetype': None, 'mimetype_inner': None, 'name': 'Catalysis of L-cysteine by IscS in the presence of IscU', 'package_id': 'doi-10-18419-darus-2483', 'position': 0, 'resource_type': 'HTML', 'size': None, 'state': 'active', 'url': 'https://doi.org/10.18419/darus-2483', 'url_type': None}], 'tags': [{'display_name': 'biotechnology', 'id': '5328eb6f-d91a-4856-a48b-bcb55b08a036', 'name': 'biotechnology', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'chemistry', 'id': '20e4e978-2a22-4286-a18b-4ae22d1ffca1', 'name': 'chemistry', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'desulfurase', 'id': '306a4853-4d46-4e45-95ad-433177ee1f88', 'name': 'desulfurase', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'enzymeml', 'id': '0b8201f3-ea70-4c06-a6e1-6366fd4d3521', 'name': 'enzymeml', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'enzymology', 'id': 'e1a87bce-16d9-4069-af31-3737213d6e3a', 'name': 'enzymology', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'kinetic-model', 'id': 'dd55f0fd-5492-4890-a86d-10b46d90ac08', 'name': 'kinetic-model', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'kinetic-modeling', 'id': '91b6cd30-7d73-4d38-8fa0-98f814c5df41', 'name': 'kinetic-modeling', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'medicine-health-and-life-sciences', 'id': 'fb4c5813-8e73-46a1-ba71-17094769b523', 'name': 'medicine-health-and-life-sciences', 'state': 'active', 'vocabulary_id': None}], 'groups': [], 'relationships_as_subject': [], 'relationships_as_object': []}, {'author': 'Malzacher, Stephan', 'author_email': None, 'creator_user_id': '1be646ae-ab26-47b8-8835-e4b27f11961e', 'id': 'doi-10-18419-darus-2470', 'isopen': False, 'license_id': '', 'license_title': '', 'maintainer': 'DaRUS', 'maintainer_email': None, 'metadata_created': '2023-05-08T19:13:44.634195', 'metadata_modified': '2023-05-08T19:13:44.634200', 'name': 'doi-10-18419-darus-2470', 'notes': '<p>The data was measured in the course of a Bachelor thesis and filled into the EnzymeML Spreadsheet. </p>\n\n<p>Measured was the absorption for the reaction from pyruvate to acetolactate. The measurements were conducted for six different pH values (in the range from pH 5 to pH8). For each of these measurements, a different Spreadsheet was created.</p>', 'num_resources': 1, 'num_tags': 6, 'organization': {'id': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'name': 'darus', 'title': 'DaRUS', 'type': 'repository', 'description': 'Chemistry collection from DaRUS, the data repository of the University of Stuttgart.', 'image_url': 'logoDarusKreis.png', 'created': '2023-05-03T09:01:04.791551', 'is_organization': True, 'approval_status': 'approved', 'state': 'active'}, 'owner_org': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'private': False, 'related_molecule': [], 'state': 'active', 'title': 'Carboligation of Pyruvate catalysed by HcAHAS C Unit', 'type': 'dataset', 'extras': [{'key': 'creator', 'value': 'Malzacher, Stephan'}, {'key': 'date', 'value': '2022-02-15T00:00:00'}, {'key': 'identifier', 'value': 'https://doi.org/10.18419/darus-2470'}, {'key': 'metadata_modified', 'value': '2022-11-29T01:00:05'}, {'key': 'set_spec', 'value': 'all'}, {'key': 'harvest_object_id', 'value': '207e6a76-55cb-4f11-b6f5-abec6759d90a'}, {'key': 'harvest_source_id', 'value': '8ba5ef26-d024-46cd-8099-94f1e74e7a36'}, {'key': 'harvest_source_title', 'value': 'Darus Test Harvest'}], 'resources': [{'cache_last_updated': None, 'cache_url': None, 'created': '2023-05-08T19:13:44.645831', 'format': 'HTML', 'hash': '', 'id': '56078bbe-6a0a-4e00-a7eb-96a529270bea', 'last_modified': None, 'metadata_modified': '2023-05-08T19:13:44.624364', 'mimetype': None, 'mimetype_inner': None, 'name': 'Carboligation of Pyruvate catalysed by HcAHAS C Unit', 'package_id': 'doi-10-18419-darus-2470', 'position': 0, 'resource_type': 'HTML', 'size': None, 'state': 'active', 'url': 'https://doi.org/10.18419/darus-2470', 'url_type': None}], 'tags': [{'display_name': 'biocatalysis', 'id': 'ff1781d4-a04e-4683-8214-ae4a122bdc9b', 'name': 'biocatalysis', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'biotechnology', 'id': '5328eb6f-d91a-4856-a48b-bcb55b08a036', 'name': 'biotechnology', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'chemistry', 'id': '20e4e978-2a22-4286-a18b-4ae22d1ffca1', 'name': 'chemistry', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'enzymeml', 'id': '0b8201f3-ea70-4c06-a6e1-6366fd4d3521', 'name': 'enzymeml', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'enzymology', 'id': 'e1a87bce-16d9-4069-af31-3737213d6e3a', 'name': 'enzymology', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'medicine-health-and-life-sciences', 'id': 'fb4c5813-8e73-46a1-ba71-17094769b523', 'name': 'medicine-health-and-life-sciences', 'state': 'active', 'vocabulary_id': None}], 'groups': [], 'relationships_as_subject': [], 'relationships_as_object': []}, {'author': 'Høst, Amalie Vang', 'author_email': None, 'creator_user_id': '1be646ae-ab26-47b8-8835-e4b27f11961e', 'id': 'doi-10-18419-darus-2469', 'isopen': False, 'license_id': '', 'license_title': '', 'maintainer': 'DaRUS', 'maintainer_email': None, 'metadata_created': '2023-05-08T19:13:44.069387', 'metadata_modified': '2023-05-08T19:13:44.069391', 'name': 'doi-10-18419-darus-2469', 'notes': 'The data is unpublished and contains absorption data over time, together with the calculated initial rates. Reaction conditions and the experimental setup are described in the additional Method section. Measured was the deactivation of Glucose Oxidase over time. The enzyme activity is tested in a colorimetric assay, measuring the change of absorbance by the change in the pink product. Absorbance values are measured at 515 m for 59 second, starting at different times after the start of the experiment (2 h, 4 h, 20 h …). In all cases, three replicates are available.', 'num_resources': 1, 'num_tags': 2, 'organization': {'id': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'name': 'darus', 'title': 'DaRUS', 'type': 'repository', 'description': 'Chemistry collection from DaRUS, the data repository of the University of Stuttgart.', 'image_url': 'logoDarusKreis.png', 'created': '2023-05-03T09:01:04.791551', 'is_organization': True, 'approval_status': 'approved', 'state': 'active'}, 'owner_org': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'private': False, 'related_molecule': [], 'state': 'active', 'title': 'Deactivation of Glucose Oxidase', 'type': 'dataset', 'extras': [{'key': 'creator', 'value': 'Høst, Amalie Vang'}, {'key': 'date', 'value': '2022-02-15T00:00:00'}, {'key': 'identifier', 'value': 'https://doi.org/10.18419/darus-2469'}, {'key': 'metadata_modified', 'value': '2022-11-29T01:00:05'}, {'key': 'set_spec', 'value': 'all'}, {'key': 'harvest_object_id', 'value': '16a666ad-651c-4212-87bc-b836d42f1d4a'}, {'key': 'harvest_source_id', 'value': '8ba5ef26-d024-46cd-8099-94f1e74e7a36'}, {'key': 'harvest_source_title', 'value': 'Darus Test Harvest'}], 'resources': [{'cache_last_updated': None, 'cache_url': None, 'created': '2023-05-08T19:13:44.070741', 'format': 'HTML', 'hash': '', 'id': '537c4e77-4d41-4744-bcc9-4fb0a9338f01', 'last_modified': None, 'metadata_modified': '2023-05-08T19:13:44.062814', 'mimetype': None, 'mimetype_inner': None, 'name': 'Deactivation of Glucose Oxidase', 'package_id': 'doi-10-18419-darus-2469', 'position': 0, 'resource_type': 'HTML', 'size': None, 'state': 'active', 'url': 'https://doi.org/10.18419/darus-2469', 'url_type': None}], 'tags': [{'display_name': 'chemistry', 'id': '20e4e978-2a22-4286-a18b-4ae22d1ffca1', 'name': 'chemistry', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'medicine-health-and-life-sciences', 'id': 'fb4c5813-8e73-46a1-ba71-17094769b523', 'name': 'medicine-health-and-life-sciences', 'state': 'active', 'vocabulary_id': None}], 'groups': [], 'relationships_as_subject': [], 'relationships_as_object': []}, {'author': 'Lagerman, Colton', 'author_email': None, 'creator_user_id': '1be646ae-ab26-47b8-8835-e4b27f11961e', 'id': 'doi-10-18419-darus-2468', 'isopen': False, 'license_id': '', 'license_title': '', 'maintainer': 'DaRUS', 'maintainer_email': None, 'metadata_created': '2023-05-08T19:13:44.035720', 'metadata_modified': '2023-05-08T19:13:44.035724', 'name': 'doi-10-18419-darus-2468', 'notes': 'Investigated was the synthesis and hydrolysis of cephalexin, and the hydrolysis of phenylglycine methyl ester by an amino ester hydrolase. The concentrations of all reactants over time were measured, for four different initial concentrations of cephalexin and phenylglycine methyl ester. For each of the reactants, 9 data points are given over a time of 30 minutes.', 'num_resources': 1, 'num_tags': 5, 'organization': {'id': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'name': 'darus', 'title': 'DaRUS', 'type': 'repository', 'description': 'Chemistry collection from DaRUS, the data repository of the University of Stuttgart.', 'image_url': 'logoDarusKreis.png', 'created': '2023-05-03T09:01:04.791551', 'is_organization': True, 'approval_status': 'approved', 'state': 'active'}, 'owner_org': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'private': False, 'related_molecule': [], 'state': 'active', 'title': 'Synthesis and Hydrolysis of Cephalexin', 'type': 'dataset', 'extras': [{'key': 'creator', 'value': 'Lagerman, Colton'}, {'key': 'date', 'value': '2022-02-15T00:00:00'}, {'key': 'identifier', 'value': 'https://doi.org/10.18419/darus-2468'}, {'key': 'metadata_modified', 'value': '2022-11-29T01:00:05'}, {'key': 'set_spec', 'value': 'all'}, {'key': 'harvest_object_id', 'value': '79e54bc7-0936-4a3b-888e-505137e63347'}, {'key': 'harvest_source_id', 'value': '8ba5ef26-d024-46cd-8099-94f1e74e7a36'}, {'key': 'harvest_source_title', 'value': 'Darus Test Harvest'}], 'resources': [{'cache_last_updated': None, 'cache_url': None, 'created': '2023-05-08T19:13:44.037275', 'format': 'HTML', 'hash': '', 'id': '1bdd6f1a-325c-4075-b56e-0b19b4b909c5', 'last_modified': None, 'metadata_modified': '2023-05-08T19:13:44.027302', 'mimetype': None, 'mimetype_inner': None, 'name': 'Synthesis and Hydrolysis of Cephalexin', 'package_id': 'doi-10-18419-darus-2468', 'position': 0, 'resource_type': 'HTML', 'size': None, 'state': 'active', 'url': 'https://doi.org/10.18419/darus-2468', 'url_type': None}], 'tags': [{'display_name': 'biotechnology', 'id': '5328eb6f-d91a-4856-a48b-bcb55b08a036', 'name': 'biotechnology', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'chemistry', 'id': '20e4e978-2a22-4286-a18b-4ae22d1ffca1', 'name': 'chemistry', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'enzymeml', 'id': '0b8201f3-ea70-4c06-a6e1-6366fd4d3521', 'name': 'enzymeml', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'enzymology', 'id': 'e1a87bce-16d9-4069-af31-3737213d6e3a', 'name': 'enzymology', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'medicine-health-and-life-sciences', 'id': 'fb4c5813-8e73-46a1-ba71-17094769b523', 'name': 'medicine-health-and-life-sciences', 'state': 'active', 'vocabulary_id': None}], 'groups': [], 'relationships_as_subject': [], 'relationships_as_object': []}, {'author': 'Ngubane, Sandile', 'author_email': None, 'creator_user_id': '1be646ae-ab26-47b8-8835-e4b27f11961e', 'id': 'doi-10-18419-darus-2467', 'isopen': False, 'license_id': '', 'license_title': '', 'maintainer': 'DaRUS', 'maintainer_email': None, 'metadata_created': '2023-05-08T19:13:43.552169', 'metadata_modified': '2023-05-08T19:13:43.552175', 'name': 'doi-10-18419-darus-2467', 'notes': 'Investigated was the oxidation of ABTS and syringaldazine by Trametes versicolor laccase. For this, the concentration of the substrate over time was measured, for different initial concentrations. All measurements were repeated for three replicates.', 'num_resources': 1, 'num_tags': 5, 'organization': {'id': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'name': 'darus', 'title': 'DaRUS', 'type': 'repository', 'description': 'Chemistry collection from DaRUS, the data repository of the University of Stuttgart.', 'image_url': 'logoDarusKreis.png', 'created': '2023-05-03T09:01:04.791551', 'is_organization': True, 'approval_status': 'approved', 'state': 'active'}, 'owner_org': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'private': False, 'related_molecule': [], 'state': 'active', 'title': 'Oxidation of ABTS by Trametes versicolor laccase', 'type': 'dataset', 'extras': [{'key': 'creator', 'value': 'Ngubane, Sandile'}, {'key': 'date', 'value': '2022-02-15T00:00:00'}, {'key': 'identifier', 'value': 'https://doi.org/10.18419/darus-2467'}, {'key': 'metadata_modified', 'value': '2022-11-29T01:00:05'}, {'key': 'set_spec', 'value': 'all'}, {'key': 'harvest_object_id', 'value': '5fa7d193-32c3-429a-b0fa-383374152fe0'}, {'key': 'harvest_source_id', 'value': '8ba5ef26-d024-46cd-8099-94f1e74e7a36'}, {'key': 'harvest_source_title', 'value': 'Darus Test Harvest'}], 'resources': [{'cache_last_updated': None, 'cache_url': None, 'created': '2023-05-08T19:13:43.560378', 'format': 'HTML', 'hash': '', 'id': '4c55ce42-c0ed-4db6-8743-41ba58b17691', 'last_modified': None, 'metadata_modified': '2023-05-08T19:13:43.544034', 'mimetype': None, 'mimetype_inner': None, 'name': 'Oxidation of ABTS by Trametes versicolor laccase', 'package_id': 'doi-10-18419-darus-2467', 'position': 0, 'resource_type': 'HTML', 'size': None, 'state': 'active', 'url': 'https://doi.org/10.18419/darus-2467', 'url_type': None}], 'tags': [{'display_name': 'biotechnology', 'id': '5328eb6f-d91a-4856-a48b-bcb55b08a036', 'name': 'biotechnology', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'chemistry', 'id': '20e4e978-2a22-4286-a18b-4ae22d1ffca1', 'name': 'chemistry', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'enzymeml', 'id': '0b8201f3-ea70-4c06-a6e1-6366fd4d3521', 'name': 'enzymeml', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'enzymology', 'id': 'e1a87bce-16d9-4069-af31-3737213d6e3a', 'name': 'enzymology', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'medicine-health-and-life-sciences', 'id': 'fb4c5813-8e73-46a1-ba71-17094769b523', 'name': 'medicine-health-and-life-sciences', 'state': 'active', 'vocabulary_id': None}], 'groups': [], 'relationships_as_subject': [], 'relationships_as_object': []}, {'author': 'Spöring, Jan-Dirk', 'author_email': None, 'creator_user_id': '1be646ae-ab26-47b8-8835-e4b27f11961e', 'id': 'doi-10-18419-darus-2466', 'isopen': False, 'license_id': '', 'license_title': '', 'maintainer': 'DaRUS', 'maintainer_email': None, 'metadata_created': '2023-05-08T19:13:43.304478', 'metadata_modified': '2023-05-08T19:13:43.304485', 'name': 'doi-10-18419-darus-2466', 'notes': 'Investigated was the ligation of two molecules propanal in organic conditions, catalysed by the benzoin aldolase, which was added in the form of lyophillised whole cells. The reaction was performed in triplicate, with 200 mM as the starting concentration of the propanal in all cases. Triethanolamine was chosen as buffer, together with Cyclopentyl methyl ether as the organic solvent, the experiment was performed at 30°C and at a pH of 9. The concentration of propioin was followed over the course of 2 hours.', 'num_resources': 1, 'num_tags': 2, 'organization': {'id': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'name': 'darus', 'title': 'DaRUS', 'type': 'repository', 'description': 'Chemistry collection from DaRUS, the data repository of the University of Stuttgart.', 'image_url': 'logoDarusKreis.png', 'created': '2023-05-03T09:01:04.791551', 'is_organization': True, 'approval_status': 'approved', 'state': 'active'}, 'owner_org': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'private': False, 'related_molecule': [], 'state': 'active', 'title': 'Propioin Synthesis using Benzoin Aldolase', 'type': 'dataset', 'extras': [{'key': 'creator', 'value': 'Spöring, Jan-Dirk'}, {'key': 'date', 'value': '2022-02-15T00:00:00'}, {'key': 'identifier', 'value': 'https://doi.org/10.18419/darus-2466'}, {'key': 'metadata_modified', 'value': '2022-11-29T01:00:05'}, {'key': 'set_spec', 'value': 'all'}, {'key': 'harvest_object_id', 'value': '713cdb26-2991-4856-bb88-501c1a878acb'}, {'key': 'harvest_source_id', 'value': '8ba5ef26-d024-46cd-8099-94f1e74e7a36'}, {'key': 'harvest_source_title', 'value': 'Darus Test Harvest'}], 'resources': [{'cache_last_updated': None, 'cache_url': None, 'created': '2023-05-08T19:13:43.305765', 'format': 'HTML', 'hash': '', 'id': '86c6a6f1-3fbc-4875-9f8a-ac8eca77d8ef', 'last_modified': None, 'metadata_modified': '2023-05-08T19:13:43.299043', 'mimetype': None, 'mimetype_inner': None, 'name': 'Propioin Synthesis using Benzoin Aldolase', 'package_id': 'doi-10-18419-darus-2466', 'position': 0, 'resource_type': 'HTML', 'size': None, 'state': 'active', 'url': 'https://doi.org/10.18419/darus-2466', 'url_type': None}], 'tags': [{'display_name': 'chemistry', 'id': '20e4e978-2a22-4286-a18b-4ae22d1ffca1', 'name': 'chemistry', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'medicine-health-and-life-sciences', 'id': 'fb4c5813-8e73-46a1-ba71-17094769b523', 'name': 'medicine-health-and-life-sciences', 'state': 'active', 'vocabulary_id': None}], 'groups': [], 'relationships_as_subject': [], 'relationships_as_object': []}, {'author': 'Jeltsch, Albert, Bashtrykov, Pavel, Adam, Sabrina, Mack, Alexandra, Emperle, Max', 'author_email': None, 'creator_user_id': '1be646ae-ab26-47b8-8835-e4b27f11961e', 'id': 'doi-10-18419-darus-2231', 'isopen': False, 'license_id': '', 'license_title': '', 'maintainer': 'DaRUS', 'maintainer_email': None, 'metadata_created': '2023-05-08T19:13:37.638623', 'metadata_modified': '2023-05-08T19:13:37.638628', 'name': 'doi-10-18419-darus-2231', 'notes': '<p>Methylation of substrate libraries<br>\nSingle-stranded DNA oligonucleotides used for generation of double stranded substrates with a distance of 12 base pairs between CpG sites were obtained from IDT. Second strand synthesis was conducted by a primer extension reaction using one universal primer. The obtained library of double-stranded DNA oligonucleotides was methylated by different purified heterotetramers containing DNMT3A catalytic domain and DNMT3A R882H catalytic domain subunit, boht either containing a His-tag or MBD-tag. For this it was incubated for 60 min at 37 °C in the presence of 0.8 mM S-adenosyl-L-methionine (Sigma) in reaction buffer (20 mM HEPES pH 7.5, 1 mM EDTA, 50 mM KCl, 0.05 mg/mL bovine serum albumin). DNA concentrations were 107 nM, DNMT3A concentrations were used between 0.05 and 0.1 µM. Reactions were stopped by shock freezing in liquid nitrogen, then treated with proteinase K for 2 hours at 42 °C. Afterwards DNA was digested with BsaI-HFv2 enzyme and a hairpin (pGAGAAGGGATGTGGATACACATCCCT) was ligated using T4 DNA ligase (NEB). DNA was bisulfite converted using EZ DNA Methylation-Lightning kit (ZYMO RESEARCH) according to the manufacturer protocol, purified and eluted with 10 µL ddH2O.</p>\n\n<p>NGS library generation<br>\nLibraries for Illumina Next Generation Sequencing (NGS) were produced with the two-step PCR approach. In the first PCR, 2 µL of bisulfite-converted DNA were amplified with the HotStartTaq DNA Polymerase (QIAGEN) and primers containing internal barcodes using following conditions: 15 min at 95 °C, 10 cycles of 30 sec at 94 °C, 30 sec at 50 °C, 1 min and 30 sec at 72 °C, and final 5 min at 72 °C; using a mixture containing 1x PCR Buffer, 1x Q-Solution, 0.2 mM dNTPs, 0.05 U/µL HotStartTaq DNA Polymerase, 0.4 µM forward and 0.4 µM reverse primers in a total volume of 20 µL. In the second PCR, 1 µL of obtained products were amplified by Phusion Polymerase (Thermo) with another set of primers to introduce adapters and indices needed for NGS (30 sec at 98 °C, 10 cycles - 10 sec at 98 °C, 40 sec at 72 °C, and 5 min at 72 °C). PCRII was carried out in 1x Phusion HF Buffer, 0.2 mM dNTPs, 0.02 U/µL Phusion HF DNA Polymerase, 0.4 µM forward and 0.4 µM reverse primers in a total volume of 20 µL. Obtained libraries were pooled in equimolar amounts, purified and sequenced in the Max Planck Genome Centre Cologne.</p>\n\n<p>Bioinformatic analysis<br>\nBioinformatic analysis of obtained NGS data was conducted with a local Galaxy server and with home written scripts. Briefly, fastq files were analyzed by FastQC, 3’ ends of the reads with a quality lower than 20 were trimmed and reads containing both full-length sense and antisense strands were selected. Next, the samples were split using the internal barcodes with respect to the different experimental conditions. Afterwards the insert DNA sequence was extracted and used for further downstream analysis. The uploaded text files contain the bisulfite converted sequences with pairs of CpG sites in 12 bp distance as described in the furhter documentation (info.pdf).</p>\n\nThe naming of the files is as follows:<br>\nName, Complex, Repeat, c(DNMT3AC) [µM]<br>\n1WW, His-WT/MBP-WT, R1, 0.1<br>\n2WW, His-WT/MBP-WT, R2, 0.05<br>\n1RR, His-R882H/MBP-R882H, R1, 0.1<br>\n2RR, His-R882H/MBP-R882H, R2, 0.07<br>\n1RW, His-R882H/MBP-WT, R1, 0.1<br>\n2RW, His-R882H/MBP-WT, R2, 0.1<br>\n1WR, His-WT/MBP-R882H, R1, 0.1<br>\n2WR, His-WT/MBP-R882H, R2, 0.1<br>', 'num_resources': 1, 'num_tags': 7, 'organization': {'id': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'name': 'darus', 'title': 'DaRUS', 'type': 'repository', 'description': 'Chemistry collection from DaRUS, the data repository of the University of Stuttgart.', 'image_url': 'logoDarusKreis.png', 'created': '2023-05-03T09:01:04.791551', 'is_organization': True, 'approval_status': 'approved', 'state': 'active'}, 'owner_org': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'private': False, 'related_molecule': [], 'state': 'active', 'title': 'Data related to "Preferential interaction of DNMT3A subunits containing the R882H cancer mutation leads to dominant changes of flanking sequence effects"', 'type': 'dataset', 'url': 'Bisulfite-seq DNA methylation analysis', 'extras': [{'key': 'contributor', 'value': 'Jeltsch, Albert'}, {'key': 'creator', 'value': 'Jeltsch, Albert'}, {'key': 'date', 'value': '2021-11-11T00:00:00'}, {'key': 'identifier', 'value': 'https://doi.org/10.18419/darus-2231'}, {'key': 'metadata_modified', 'value': '2022-11-29T01:00:04'}, {'key': 'relation', 'value': 'Jeltsch, Albert; Bashtrykov, Pavel; Adam, Sabrina; Kunert, Stefan: Data related to "Structural and biochemical insight into the mechanism of dual CpG site binding and methylation by DNMT3A. \nDOI: <a href="https://doi.org/10.18419/darus-1781">10.18419/darus-1781</a>'}, {'key': 'set_spec', 'value': 'all'}, {'key': 'harvest_object_id', 'value': '1b040aab-70bf-4f4e-890d-82448acb4453'}, {'key': 'harvest_source_id', 'value': '8ba5ef26-d024-46cd-8099-94f1e74e7a36'}, {'key': 'harvest_source_title', 'value': 'Darus Test Harvest'}], 'resources': [{'cache_last_updated': None, 'cache_url': None, 'created': '2023-05-08T19:13:37.642416', 'format': 'HTML', 'hash': '', 'id': 'd6bfe87a-4992-4c42-8965-dc6141fe8428', 'last_modified': None, 'metadata_modified': '2023-05-08T19:13:37.627995', 'mimetype': None, 'mimetype_inner': None, 'name': 'Data related to "Preferential interaction of DNMT3A subunits containing the R882H cancer mutation leads to dominant changes of flanking sequence effects"', 'package_id': 'doi-10-18419-darus-2231', 'position': 0, 'resource_type': 'HTML', 'size': None, 'state': 'active', 'url': 'https://doi.org/10.18419/darus-2231', 'url_type': None}], 'tags': [{'display_name': 'chemistry', 'id': '20e4e978-2a22-4286-a18b-4ae22d1ffca1', 'name': 'chemistry', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dna-methylation', 'id': 'e7346e2a-6a27-4ef7-9a8a-67d86bc040c4', 'name': 'dna-methylation', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dna-methyltransferase', 'id': '535aedd5-dcf4-4470-90a5-ab689b1b456e', 'name': 'dna-methyltransferase', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dna-sequences-after-hairpin-ligation-and-bisulfite-conversion', 'id': '33e68726-8dbf-424a-b07f-92860bc8116f', 'name': 'dna-sequences-after-hairpin-ligation-and-bisulfite-conversion', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dnmt3a', 'id': '1ce1eeaf-6ac8-4fb0-9456-fbd33ca8c0a9', 'name': 'dnmt3a', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'enzyme-assay', 'id': 'f4d04af7-98e2-455a-a8ec-5ae1aab87681', 'name': 'enzyme-assay', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'medicine-health-and-life-sciences', 'id': 'fb4c5813-8e73-46a1-ba71-17094769b523', 'name': 'medicine-health-and-life-sciences', 'state': 'active', 'vocabulary_id': None}], 'groups': [], 'relationships_as_subject': [], 'relationships_as_object': []}, {'author': 'Wang, Shuo, Findeisen, Lukas, Leptihn, Sebastian, Wallace, Mark Ian, Hörning, Marcel, Nussberger, Stephan', 'author_email': None, 'creator_user_id': '1be646ae-ab26-47b8-8835-e4b27f11961e', 'id': 'doi-10-18419-darus-2158', 'isopen': False, 'language': 'English', 'license_id': '', 'license_title': '', 'maintainer': 'DaRUS', 'maintainer_email': None, 'metadata_created': '2023-05-08T19:13:34.713708', 'metadata_modified': '2023-05-08T19:13:34.713713', 'name': 'doi-10-18419-darus-2158', 'notes': 'The role of lateral diffusion of proteins in the membrane in the context of function has not been examined extensively. The data set addresses the relationship between protein lateral diffusion and channel activity of the general protein import pore of mitochondria (TOM-CC). Optical ion flux sensing through single TOM-CC molecules shows that TOM-CC can occupy three ion permeability states. Whereas freely diffusing TOM-CC molecules are preferentially found in a high permeability state, physical tethering to an agarose support causes the channels to transition to intermediate and low permeability states. This data shows that combinatorial opening and closing of the two pores of TOM-CC correlates with lateral protein diffusion in the membrane plane, and that the complex has mechanosensitive-like properties. This is the first demonstration of beta-barrel protein mechanosensitivity, and has direct conceptual consequences for the understanding of the process of mitochondrial protein import. The approach provides a novel tool to simultaneously study the interplay of membrane protein diffusion and channel dynamics.', 'num_resources': 1, 'num_tags': 9, 'organization': {'id': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'name': 'darus', 'title': 'DaRUS', 'type': 'repository', 'description': 'Chemistry collection from DaRUS, the data repository of the University of Stuttgart.', 'image_url': 'logoDarusKreis.png', 'created': '2023-05-03T09:01:04.791551', 'is_organization': True, 'approval_status': 'approved', 'state': 'active'}, 'owner_org': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'private': False, 'related_molecule': [], 'state': 'active', 'title': 'Data for: Correlation of mitochondrial TOM core complex stop-and-go and open-closed channel dynamics', 'type': 'dataset', 'extras': [{'key': 'contributor', 'value': 'Wang, Shuo'}, {'key': 'creator', 'value': 'Wang, Shuo'}, {'key': 'date', 'value': '2022-05-18T00:00:00'}, {'key': 'identifier', 'value': 'https://doi.org/10.18419/darus-2158'}, {'key': 'metadata_modified', 'value': '2022-11-29T01:00:04'}, {'key': 'set_spec', 'value': 'all'}, {'key': 'harvest_object_id', 'value': '9320b02c-d239-48b3-bb86-ae89718444f1'}, {'key': 'harvest_source_id', 'value': '8ba5ef26-d024-46cd-8099-94f1e74e7a36'}, {'key': 'harvest_source_title', 'value': 'Darus Test Harvest'}], 'resources': [{'cache_last_updated': None, 'cache_url': None, 'created': '2023-05-08T19:13:34.728563', 'format': 'HTML', 'hash': '', 'id': 'daecd0b5-53e4-4e0e-8d84-7a071dbca248', 'last_modified': None, 'metadata_modified': '2023-05-08T19:13:34.701753', 'mimetype': None, 'mimetype_inner': None, 'name': 'Data for: Correlation of mitochondrial TOM core complex stop-and-go and open-closed channel dynamics', 'package_id': 'doi-10-18419-darus-2158', 'position': 0, 'resource_type': 'HTML', 'size': None, 'state': 'active', 'url': 'https://doi.org/10.18419/darus-2158', 'url_type': None}], 'tags': [{'display_name': 'chemistry', 'id': '20e4e978-2a22-4286-a18b-4ae22d1ffca1', 'name': 'chemistry', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'droplet-interface-bilayers', 'id': '52e9d472-4391-4ebc-8b19-4f320334249f', 'name': 'droplet-interface-bilayers', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'ion-channel', 'id': '9ebe03d5-8264-442c-b605-78512dc32208', 'name': 'ion-channel', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'lateral-membrane-protein-diffusion', 'id': '99682dff-c4d7-4c6f-9a1b-08b0d4eaa43a', 'name': 'lateral-membrane-protein-diffusion', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'medicine-health-and-life-sciences', 'id': 'fb4c5813-8e73-46a1-ba71-17094769b523', 'name': 'medicine-health-and-life-sciences', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'mitochondria', 'id': '2c5fa7ac-9da1-4b0f-b05a-6fccf55c6727', 'name': 'mitochondria', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'physics', 'id': '820fb04d-8f9c-45ca-9a54-9054d91e527b', 'name': 'physics', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'single-molecule-tirf-microscopy', 'id': '7b1457ba-2afe-44a8-8601-999765927a0f', 'name': 'single-molecule-tirf-microscopy', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'tom-complex', 'id': 'de3ce9ac-ad42-4e72-bf81-b15bf793f908', 'name': 'tom-complex', 'state': 'active', 'vocabulary_id': None}], 'groups': [], 'relationships_as_subject': [], 'relationships_as_object': []}, {'author': 'Trivedi, Zubin', 'author_email': None, 'creator_user_id': '1be646ae-ab26-47b8-8835-e4b27f11961e', 'id': 'doi-10-18419-darus-2032', 'isopen': False, 'license_id': '', 'license_title': '', 'maintainer': 'DaRUS', 'maintainer_email': None, 'metadata_created': '2023-05-08T19:13:28.124483', 'metadata_modified': '2023-05-08T19:13:28.124488', 'name': 'doi-10-18419-darus-2032', 'notes': 'A commercially available bone cement (Vertecem V+) is subjected to an oscillometric test using a parallel plate rheomter in order to characterise its viscoelastic properties. For this, a small amount of bone cement is placed between the plates of the rheometer and subjected to oscillations with gradually increasing angular frequency upto 40 rad/s. This cycle is repeated to obtain the change in properties arising due to the curing of the bone cement until there is no significant change with time. The results are given in form of an Excel file as well as text csv format.', 'num_resources': 1, 'num_tags': 3, 'organization': {'id': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'name': 'darus', 'title': 'DaRUS', 'type': 'repository', 'description': 'Chemistry collection from DaRUS, the data repository of the University of Stuttgart.', 'image_url': 'logoDarusKreis.png', 'created': '2023-05-03T09:01:04.791551', 'is_organization': True, 'approval_status': 'approved', 'state': 'active'}, 'owner_org': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'private': False, 'related_molecule': [], 'state': 'active', 'title': 'Measuring the viscoelastic properties and curing characterstics of Vertecem V+ bone cement using oscillatory rheometer', 'type': 'dataset', 'extras': [{'key': 'contributor', 'value': 'Trivedi, Zubin'}, {'key': 'creator', 'value': 'Trivedi, Zubin'}, {'key': 'date', 'value': '2021-06-23T00:00:00'}, {'key': 'identifier', 'value': 'https://doi.org/10.18419/darus-2032'}, {'key': 'metadata_modified', 'value': '2022-11-29T01:00:04'}, {'key': 'relation', 'value': 'Trivedi, Zubin, 2021, "Dynamic CT imaging of bone cement injection through aluminium foam", <a href="https://doi.org/10.18419/darus-2037">https://doi.org/10.18419/darus-2037</a>, DaRUS'}, {'key': 'set_spec', 'value': 'all'}, {'key': 'harvest_object_id', 'value': 'ed5dbb6d-e0f8-49d8-9133-02891e9cf6b7'}, {'key': 'harvest_source_id', 'value': '8ba5ef26-d024-46cd-8099-94f1e74e7a36'}, {'key': 'harvest_source_title', 'value': 'Darus Test Harvest'}], 'resources': [{'cache_last_updated': None, 'cache_url': None, 'created': '2023-05-08T19:13:28.125838', 'format': 'HTML', 'hash': '', 'id': '91fed24d-edee-4497-98ea-f353be2590f0', 'last_modified': None, 'metadata_modified': '2023-05-08T19:13:28.117110', 'mimetype': None, 'mimetype_inner': None, 'name': 'Measuring the viscoelastic properties and curing characterstics of Vertecem V+ bone cement using oscillatory rheometer', 'package_id': 'doi-10-18419-darus-2032', 'position': 0, 'resource_type': 'HTML', 'size': None, 'state': 'active', 'url': 'https://doi.org/10.18419/darus-2032', 'url_type': None}], 'tags': [{'display_name': 'chemistry', 'id': '20e4e978-2a22-4286-a18b-4ae22d1ffca1', 'name': 'chemistry', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'engineering', 'id': '3ff6cbc9-08ad-4fd1-aa1e-6676db9d1e1c', 'name': 'engineering', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'medicine-health-and-life-sciences', 'id': 'fb4c5813-8e73-46a1-ba71-17094769b523', 'name': 'medicine-health-and-life-sciences', 'state': 'active', 'vocabulary_id': None}], 'groups': [], 'relationships_as_subject': [], 'relationships_as_object': []}, {'author': 'Jeltsch, Albert, Bashtrykov, Pavel, Adam, Sabrina, Kunert, Stefan', 'author_email': None, 'creator_user_id': '1be646ae-ab26-47b8-8835-e4b27f11961e', 'id': 'doi-10-18419-darus-1781', 'isopen': False, 'license_id': '', 'license_title': '', 'maintainer': 'DaRUS', 'maintainer_email': None, 'metadata_created': '2023-05-08T19:13:12.421098', 'metadata_modified': '2023-05-08T19:13:12.421106', 'name': 'doi-10-18419-darus-1781', 'notes': 'Methylation of substrate libraries<br>\nSingle-stranded DNA oligonucleotides used for generation of double stranded substrates with different distance between CpG sites were obtained from IDT. Sixteen single-stranded oligonucleotides were pooled in equimolar amounts and the second strand synthesis was conducted by a primer extension reaction using one universal primer. The obtained mix of double-stranded DNA oligonucleotides was methylated by DNMT3A catalytic domain and DNMT3A/3L and incubated for 60 min at 37 °C in the presence of 0.8 mM S-adenosyl-L-methionine (Sigma) in reaction buffer (20 mM HEPES pH 7.5, 1 mM EDTA, 50 mM KCl, 0.05 mg/mL bovine serum albumin). For DNMT3A, concentrations of 0.25 µM, 0,5 µM, 1 µM and 2 µM were used, for DNMT3A/3L 0.125 µM and 0.25 µM. In addition, a no-enzyme control was processed identically to all other samples. Reactions were stopped by shock freezing in liquid nitrogen, then treated with proteinase K for 2 hours at 42 °C. Afterwards DNA was digested with BsaI-HFv2 enzyme and a hairpin (pGAGAAGGGATGTGGATACACATCCCT) was ligated using T4 DNA ligase (NEB). DNA was bisulfite converted using EZ DNA Methylation-Lightning kit (ZYMO RESEARCH) according to the manufacturer protocol, purified and eluted with 10 µL ddH2O.<br><br>\n\nNGS library generation<br>\nLibraries for Illumina Next Generation Sequencing (NGS) were produced with the two-step PCR approach. In the first PCR, 2 µL of bisulfite-converted DNA were amplified with the HotStartTaq DNA Polymerase (QIAGEN) and primers containing internal barcodes using following conditions: 15 min at 95 °C, 10 cycles of 30 sec at 94 °C, 30 sec at 50 °C, 1 min and 30 sec at 72 °C, and final 5 min at 72 °C; using a mixture containing 1x PCR Buffer, 1x Q-Solution, 0.2 mM dNTPs, 0.05 U/µL HotStartTaq DNA Polymerase, 0.4 µM forward and 0.4 µM reverse primers in a total volume of 20 µL. In the second PCR, 1 µL of obtained products were amplified by Phusion Polymerase (Thermo) with another set of primers to introduce adapters and indices needed for NGS (30 sec at 98 °C, 10 cycles - 10 sec at 98 °C, 40 sec at 72 °C, and 5 min at 72 °C). PCRII was carried out in 1x Phusion HF Buffer, 0.2 mM dNTPs, 0.02 U/µL Phusion HF DNA Polymerase, 0.4 µM forward and 0.4 µM reverse primers in a total volume of 20 µL. Obtained libraries were pooled in equimolar amounts, purified and sequenced in the Max Planck Genome Centre Cologne.<br><br>\n\nBioinformatic analysis<br>\nBioinformatic analysis of obtained NGS data was conducted with a local Galaxy server and with home written scripts. Briefly, fastq files were analyzed by FastQC, 3’ ends of the reads with a quality lower than 20 were trimmed and reads containing both full-length sense and antisense strands were selected. Next, the samples were split using the internal barcodes with respect to the different experimental conditions. Afterwards the insert DNA sequence was extracted and used for further downstream analysis. The uploaded text files contain the bisulfite converted sequences with pairs of CpG sites in variable distance as described in the furhter documentation (info.pdf).', 'num_resources': 1, 'num_tags': 10, 'organization': {'id': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'name': 'darus', 'title': 'DaRUS', 'type': 'repository', 'description': 'Chemistry collection from DaRUS, the data repository of the University of Stuttgart.', 'image_url': 'logoDarusKreis.png', 'created': '2023-05-03T09:01:04.791551', 'is_organization': True, 'approval_status': 'approved', 'state': 'active'}, 'owner_org': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'private': False, 'related_molecule': [], 'state': 'active', 'title': 'Data related to "Structural and biochemical insight into the mechanism of dual CpG site binding and methylation by DNMT3A"', 'type': 'dataset', 'url': 'Bisulfite-seq DNA methylation analysis', 'extras': [{'key': 'contributor', 'value': 'Jeltsch, Albert'}, {'key': 'creator', 'value': 'Jeltsch, Albert'}, {'key': 'date', 'value': '2021-04-12T00:00:00'}, {'key': 'identifier', 'value': 'https://doi.org/10.18419/darus-1781'}, {'key': 'metadata_modified', 'value': '2022-11-29T01:00:04'}, {'key': 'set_spec', 'value': 'all'}, {'key': 'harvest_object_id', 'value': '82dc57f2-448f-40f0-b6c4-20df46edf1e7'}, {'key': 'harvest_source_id', 'value': '8ba5ef26-d024-46cd-8099-94f1e74e7a36'}, {'key': 'harvest_source_title', 'value': 'Darus Test Harvest'}], 'resources': [{'cache_last_updated': None, 'cache_url': None, 'created': '2023-05-08T19:13:12.423312', 'format': 'HTML', 'hash': '', 'id': 'bca3e433-3a6d-40ad-8c5f-36ef67a4538e', 'last_modified': None, 'metadata_modified': '2023-05-08T19:13:12.408629', 'mimetype': None, 'mimetype_inner': None, 'name': 'Data related to "Structural and biochemical insight into the mechanism of dual CpG site binding and methylation by DNMT3A"', 'package_id': 'doi-10-18419-darus-1781', 'position': 0, 'resource_type': 'HTML', 'size': None, 'state': 'active', 'url': 'https://doi.org/10.18419/darus-1781', 'url_type': None}], 'tags': [{'display_name': 'chemistry', 'id': '20e4e978-2a22-4286-a18b-4ae22d1ffca1', 'name': 'chemistry', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'co-methylation', 'id': '6b0d2026-099d-4406-9f1e-65108985c704', 'name': 'co-methylation', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dna-methylation', 'id': 'e7346e2a-6a27-4ef7-9a8a-67d86bc040c4', 'name': 'dna-methylation', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dna-methyltransferase', 'id': '535aedd5-dcf4-4470-90a5-ab689b1b456e', 'name': 'dna-methyltransferase', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dna-sequences-after-hairpin-ligation-and-bisulfite-conversion', 'id': '33e68726-8dbf-424a-b07f-92860bc8116f', 'name': 'dna-sequences-after-hairpin-ligation-and-bisulfite-conversion', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dnmt3a', 'id': '1ce1eeaf-6ac8-4fb0-9456-fbd33ca8c0a9', 'name': 'dnmt3a', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dnmt3l', 'id': '95a1171d-2745-4af6-b00a-9d95803a3ce8', 'name': 'dnmt3l', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'enzyme-assay', 'id': 'f4d04af7-98e2-455a-a8ec-5ae1aab87681', 'name': 'enzyme-assay', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'medicine-health-and-life-sciences', 'id': 'fb4c5813-8e73-46a1-ba71-17094769b523', 'name': 'medicine-health-and-life-sciences', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'ngs-bisulfite-sequencing', 'id': '13051ab0-0f55-4da6-9725-55108bf87ee1', 'name': 'ngs-bisulfite-sequencing', 'state': 'active', 'vocabulary_id': None}], 'groups': [], 'relationships_as_subject': [], 'relationships_as_object': []}, {'author': 'Jeltsch, Albert, Bashtrykov, Pavel, Bröhm, Alexander, Dukatz, Michael, Adam, Sabrina', 'author_email': None, 'creator_user_id': '1be646ae-ab26-47b8-8835-e4b27f11961e', 'id': 'doi-10-18419-darus-1252', 'isopen': False, 'language': 'English', 'license_id': '', 'license_title': '', 'maintainer': 'DaRUS', 'maintainer_email': None, 'metadata_created': '2023-05-08T19:12:18.866702', 'metadata_modified': '2023-05-08T19:12:18.866707', 'name': 'doi-10-18419-darus-1252', 'notes': '<p>Methylation experiments:<br> \nFor the competitive nucleosome methylation experiments, 0.6 pmol of each nucleosome variant were digested with MluI (NEB) for 60 min at 37°C in 10 µL NEB Cutsmart buffer (50 mM KOAc/20 mM Tris-acetate pH 7.9, 10 mM Magnesium Acetate, 100 µg/mL BSA) to remove residual unbound DNA. Afterwards, DNMT3A2 or DNMT3AC was added to the mixture to a final concentration ranging from 0.5 µM to 3 µM and in 80 µL NEB Cutsmart buffer supplemented with 10 mM EDTA and 25 µM AdoMet (Perkin Elmer). The methylation reaction was allowed to proceed for 2 h at 37°C. To stop the reaction and remove all nucleosome-bound proteins, proteinase K was added to the reaction and the sample was incubated for further 60 min at 37°C. The resulting unbound DNA was purified from the reaction mixture using the Nucleospin Gel and PCR cleanup kit (Macherey-Nagel). Bisulfite conversion of the methylated DNA was performed using the EZ DNA Methylation-Lightning kit (Zymo Research). Methylation of free DNA was conducted the same way using 15 µM DNA.</p>\n\n<p>Library preparation and sequencing analysis: <br>\nSample-specific barcodes and indices were added to the DNA by PCR amplification in a two-step PCR process. Briefly, in the first PCR, barcoded primers were used to amplify the bisulfite converted nucleosome DNA using the HotStartTaq Polymerase (Qiagen) and the resulting 321 bp fragment was purified using the Nucleospin Gel and PCR cleanup kit (Macherey-Nagel). In the second PCR step, adaptors and indices required for sequencing were added by amplification with the respective primers and the Phusion polymerase (ThermoFisher). The final 390-bp product was purified and used for Illumina paired end 2x250 bp sequencing. Datasets were analyzed using a local instance of the Galaxy bioinformatics server. Sequence reads were trimmed with the Trim Galore! Tool (developed by Felix Krueger at the Babraham Institute) and subsequently paired using PEAR. The reads were filtered according to the expected DNA length using the Filter FASTQ tool and mapped to the corresponding reference sequence using bwameth to determine the percentage of methylated CpGs.</p>\n\nThe naming of the files is described in the Supplemental Table 1 of the accompanying manuscript.', 'num_resources': 1, 'num_tags': 11, 'organization': {'id': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'name': 'darus', 'title': 'DaRUS', 'type': 'repository', 'description': 'Chemistry collection from DaRUS, the data repository of the University of Stuttgart.', 'image_url': 'logoDarusKreis.png', 'created': '2023-05-03T09:01:04.791551', 'is_organization': True, 'approval_status': 'approved', 'state': 'active'}, 'owner_org': '9a7d2a53-21f6-412a-afb9-a15122df0640', 'private': False, 'related_molecule': [], 'state': 'active', 'title': 'NGS data related to Bröhm et al.: Methylation of recombinant mononucleosomes by DNMT3A demonstrates efficient linker DNA methylation and a role of H3K36me3', 'type': 'dataset', 'url': 'Bisulfite-seq DNA methylation analysis', 'extras': [{'key': 'contributor', 'value': 'Jeltsch, Albert'}, {'key': 'creator', 'value': 'Jeltsch, Albert'}, {'key': 'date', 'value': '2021-01-26T00:00:00'}, {'key': 'identifier', 'value': 'https://doi.org/10.18419/darus-1252'}, {'key': 'metadata_modified', 'value': '2022-11-29T01:00:03'}, {'key': 'set_spec', 'value': 'all'}, {'key': 'harvest_object_id', 'value': '9c67c448-757f-42a9-8e75-d628b27b607f'}, {'key': 'harvest_source_id', 'value': '8ba5ef26-d024-46cd-8099-94f1e74e7a36'}, {'key': 'harvest_source_title', 'value': 'Darus Test Harvest'}], 'resources': [{'cache_last_updated': None, 'cache_url': None, 'created': '2023-05-08T19:12:18.904606', 'format': 'HTML', 'hash': '', 'id': '81932d4c-ba3b-4647-888a-e382236af3ef', 'last_modified': None, 'metadata_modified': '2023-05-08T19:12:18.852806', 'mimetype': None, 'mimetype_inner': None, 'name': 'NGS data related to Bröhm et al.: Methylation of recombinant mononucleosomes by DNMT3A demonstrates efficient linker DNA methylation and a role of H3K36me3', 'package_id': 'doi-10-18419-darus-1252', 'position': 0, 'resource_type': 'HTML', 'size': None, 'state': 'active', 'url': 'https://doi.org/10.18419/darus-1252', 'url_type': None}], 'tags': [{'display_name': 'bisulfite-sequencing', 'id': 'cc9cbc1b-80c9-46c0-bfa3-e6f82923eb72', 'name': 'bisulfite-sequencing', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'chemistry', 'id': '20e4e978-2a22-4286-a18b-4ae22d1ffca1', 'name': 'chemistry', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dna-methylation', 'id': 'e7346e2a-6a27-4ef7-9a8a-67d86bc040c4', 'name': 'dna-methylation', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dna-methyltransferase', 'id': '535aedd5-dcf4-4470-90a5-ab689b1b456e', 'name': 'dna-methyltransferase', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'dnmt3a', 'id': '1ce1eeaf-6ac8-4fb0-9456-fbd33ca8c0a9', 'name': 'dnmt3a', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'enzyme-assay', 'id': 'f4d04af7-98e2-455a-a8ec-5ae1aab87681', 'name': 'enzyme-assay', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'h3k36me3', 'id': 'af9778ad-0c94-4f5e-b2a6-069aa5fc5143', 'name': 'h3k36me3', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'medicine-health-and-life-sciences', 'id': 'fb4c5813-8e73-46a1-ba71-17094769b523', 'name': 'medicine-health-and-life-sciences', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'ngs-bisulfite-sequencing', 'id': '13051ab0-0f55-4da6-9725-55108bf87ee1', 'name': 'ngs-bisulfite-sequencing', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'nucleosome', 'id': '72b78fb8-b32d-4411-9f81-ef8cde132ae7', 'name': 'nucleosome', 'state': 'active', 'vocabulary_id': None}, {'display_name': 'raw-dna-sequences-in-fastqsanger-format', 'id': '690b0510-4dfe-487d-89b3-878664cbb4d8', 'name': 'raw-dna-sequences-in-fastqsanger-format', 'state': 'active', 'vocabulary_id': None}], 'groups': [], 'relationships_as_subject': [], 'relationships_as_object': []}], 'sort': 'score desc, metadata_modified desc', 'search_facets': {'organization': {'title': 'organization', 'items': [{'name': 'darus', 'display_name': 'DaRUS', 'count': 15}]}, 'measurement_technique': {'title': 'measurement_technique', 'items': []}, 'tags': {'title': 'tags', 'items': [{'name': 'web-databases', 'display_name': 'web-databases', 'count': 1}, {'name': 'videos', 'display_name': 'videos', 'count': 1}, {'name': 'tom-complex', 'display_name': 'tom-complex', 'count': 1}, {'name': 'systems-biology-graphical-notation', 'display_name': 'systems-biology-graphical-notation', 'count': 1}, {'name': 'systems-biology', 'display_name': 'systems-biology', 'count': 1}, {'name': 'single-molecule-tirf-microscopy', 'display_name': 'single-molecule-tirf-microscopy', 'count': 1}, {'name': 'sbgn', 'display_name': 'sbgn', 'count': 1}, {'name': 'raw-dna-sequences-in-fastqsanger-format', 'display_name': 'raw-dna-sequences-in-fastqsanger-format', 'count': 2}, {'name': 'raw-dna-sequences-extracted-from-fastq-ngs-files-bisulfite-seq-of-5mc-analysis', 'display_name': 'raw-dna-sequences-extracted-from-fastq-ngs-files-bisulfite-seq-of-5mc-analysis', 'count': 1}, {'name': 'quorum-sensing-microbiology', 'display_name': 'quorum-sensing-microbiology', 'count': 1}, {'name': 'quorum-quenching-microbiology', 'display_name': 'quorum-quenching-microbiology', 'count': 1}, {'name': 'protein-methyltransferases', 'display_name': 'protein-methyltransferases', 'count': 1}, {'name': 'primary-data-tables', 'display_name': 'primary-data-tables', 'count': 1}, {'name': 'physics', 'display_name': 'physics', 'count': 1}, {'name': 'nucleosome', 'display_name': 'nucleosome', 'count': 1}, {'name': 'ngs-bisulfite-sequencing', 'display_name': 'ngs-bisulfite-sequencing', 'count': 3}, {'name': 'molecular-models-of-protein-structures', 'display_name': 'molecular-models-of-protein-structures', 'count': 1}, {'name': 'mitochondria', 'display_name': 'mitochondria', 'count': 1}, {'name': 'medicine-health-and-life-sciences', 'display_name': 'medicine-health-and-life-sciences', 'count': 15}, {'name': 'md-simulations-python-scripts', 'display_name': 'md-simulations-python-scripts', 'count': 1}, {'name': 'md-simulations-analysis-python-scripts', 'display_name': 'md-simulations-analysis-python-scripts', 'count': 1}, {'name': 'lateral-membrane-protein-diffusion', 'display_name': 'lateral-membrane-protein-diffusion', 'count': 1}, {'name': 'kinetic-modeling', 'display_name': 'kinetic-modeling', 'count': 1}, {'name': 'kinetic-model', 'display_name': 'kinetic-model', 'count': 1}, {'name': 'ion-channel', 'display_name': 'ion-channel', 'count': 1}, {'name': 'h3k36me3', 'display_name': 'h3k36me3', 'count': 1}, {'name': 'enzymology', 'display_name': 'enzymology', 'count': 4}, {'name': 'enzymeml', 'display_name': 'enzymeml', 'count': 4}, {'name': 'enzyme-specificity', 'display_name': 'enzyme-specificity', 'count': 2}, {'name': 'enzyme-assay', 'display_name': 'enzyme-assay', 'count': 5}, {'name': 'engineering', 'display_name': 'engineering', 'count': 1}, {'name': 'droplet-interface-bilayers', 'display_name': 'droplet-interface-bilayers', 'count': 1}, {'name': 'dnmt3l', 'display_name': 'dnmt3l', 'count': 1}, {'name': 'dnmt3a', 'display_name': 'dnmt3a', 'count': 4}, {'name': 'dnmt1', 'display_name': 'dnmt1', 'count': 1}, {'name': 'dna-sequences-after-hairpin-ligation-and-bisulfite-conversion', 'display_name': 'dna-sequences-after-hairpin-ligation-and-bisulfite-conversion', 'count': 2}, {'name': 'dna-methyltransferase', 'display_name': 'dna-methyltransferase', 'count': 5}, {'name': 'dna-methylation', 'display_name': 'dna-methylation', 'count': 5}, {'name': 'desulfurase', 'display_name': 'desulfurase', 'count': 1}, {'name': 'computer-and-information-science', 'display_name': 'computer-and-information-science', 'count': 2}, {'name': 'co-methylation', 'display_name': 'co-methylation', 'count': 1}, {'name': 'chemistry', 'display_name': 'chemistry', 'count': 15}, {'name': 'bisulfite-sequencing', 'display_name': 'bisulfite-sequencing', 'count': 2}, {'name': 'biotechnology', 'display_name': 'biotechnology', 'count': 4}, {'name': 'biocatalysis', 'display_name': 'biocatalysis', 'count': 1}]}, 'license_id': {'title': 'license_id', 'items': [{'name': '', 'display_name': '', 'count': 15}]}}}, 'search_params': None} |
